ID: 1099816948

View in Genome Browser
Species Human (GRCh38)
Location 12:87661495-87661517
Sequence GGTGGGACTTAAAATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099816944_1099816948 17 Left 1099816944 12:87661455-87661477 CCACAAAAAATCTCAGGATATCT No data
Right 1099816948 12:87661495-87661517 GGTGGGACTTAAAATTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099816948 Original CRISPR GGTGGGACTTAAAATTAGAG AGG Intergenic
No off target data available for this crispr