ID: 1099821351

View in Genome Browser
Species Human (GRCh38)
Location 12:87715107-87715129
Sequence AGTCATCTGCAAAGAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099821347_1099821351 29 Left 1099821347 12:87715055-87715077 CCATGGTTAAGTGTTCAGTTTCT No data
Right 1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG No data
1099821346_1099821351 30 Left 1099821346 12:87715054-87715076 CCCATGGTTAAGTGTTCAGTTTC No data
Right 1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG No data
1099821349_1099821351 -8 Left 1099821349 12:87715092-87715114 CCTCAAAAAGAGAGTAGTCATCT No data
Right 1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099821351 Original CRISPR AGTCATCTGCAAAGAATGGC AGG Intergenic
No off target data available for this crispr