ID: 1099824369

View in Genome Browser
Species Human (GRCh38)
Location 12:87756119-87756141
Sequence AAATTTTACTAAATAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099824368_1099824369 -2 Left 1099824368 12:87756098-87756120 CCTGTGAAAGAAAATGAAATAAA No data
Right 1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG No data
1099824367_1099824369 28 Left 1099824367 12:87756068-87756090 CCAGTAAATTAGATCATGGAGAA No data
Right 1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099824369 Original CRISPR AAATTTTACTAAATAGCAGT TGG Intergenic
No off target data available for this crispr