ID: 1099825437

View in Genome Browser
Species Human (GRCh38)
Location 12:87771114-87771136
Sequence GGCTTATTCTCTTGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099825431_1099825437 26 Left 1099825431 12:87771065-87771087 CCAAAGGATTAGTGACAAGCATG No data
Right 1099825437 12:87771114-87771136 GGCTTATTCTCTTGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099825437 Original CRISPR GGCTTATTCTCTTGGAAGCC AGG Intergenic
No off target data available for this crispr