ID: 1099832563

View in Genome Browser
Species Human (GRCh38)
Location 12:87863727-87863749
Sequence TCTTTTCTTTTGAAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099832558_1099832563 25 Left 1099832558 12:87863679-87863701 CCTTAAATATAGTAGGCACTCAA No data
Right 1099832563 12:87863727-87863749 TCTTTTCTTTTGAAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099832563 Original CRISPR TCTTTTCTTTTGAAAGGGGA TGG Intergenic
No off target data available for this crispr