ID: 1099837392

View in Genome Browser
Species Human (GRCh38)
Location 12:87924038-87924060
Sequence AAGTATCTACAGATATAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099837389_1099837392 -3 Left 1099837389 12:87924018-87924040 CCAGAATTCAGAGCCCAGTGAAG No data
Right 1099837392 12:87924038-87924060 AAGTATCTACAGATATAGCAAGG No data
1099837387_1099837392 2 Left 1099837387 12:87924013-87924035 CCCTTCCAGAATTCAGAGCCCAG No data
Right 1099837392 12:87924038-87924060 AAGTATCTACAGATATAGCAAGG No data
1099837388_1099837392 1 Left 1099837388 12:87924014-87924036 CCTTCCAGAATTCAGAGCCCAGT No data
Right 1099837392 12:87924038-87924060 AAGTATCTACAGATATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099837392 Original CRISPR AAGTATCTACAGATATAGCA AGG Intergenic
No off target data available for this crispr