ID: 1099842891

View in Genome Browser
Species Human (GRCh38)
Location 12:87988799-87988821
Sequence GTGGATTTTAAGTACAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 569}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099842891 Original CRISPR GTGGATTTTAAGTACAGTTA AGG Intronic
902152756 1:14457994-14458016 GTGTGTTTTTAGTAGAGTTATGG + Intergenic
902347164 1:15826799-15826821 GTGTTTTTTTAGTAGAGTTAGGG + Intergenic
902466256 1:16620422-16620444 GGGGATTCTAAGGACAGTGAGGG + Intergenic
902508426 1:16952881-16952903 GGGGATTCTAAGGACAGTGAGGG - Intronic
902634692 1:17727408-17727430 TTGTATTTTTAGTACAGTTGGGG + Intergenic
903112805 1:21151410-21151432 TTGTATTTTTAGTACAGATAGGG + Intronic
903217189 1:21849850-21849872 GTGGATTTTCAGTAGAGATGGGG + Intronic
903253986 1:22079439-22079461 GTTGATTTAAAAAACAGTTATGG - Intronic
903831006 1:26174740-26174762 TTGGATTTTTAGTACAGACAGGG + Intergenic
904132403 1:28284660-28284682 TTGTATTTTCAGTACAGTTGGGG - Intergenic
905286990 1:36887580-36887602 TTGTATTTTTAGTACAGGTAGGG - Intronic
906327762 1:44858635-44858657 TTGTATTTTTAGTACAGATAGGG + Intronic
908309179 1:62858779-62858801 GAGTGTTTTAAGTACAGTGAGGG + Intronic
908563481 1:65330639-65330661 GTGTATTTTTAGTAGAGATAGGG + Intronic
908952271 1:69575808-69575830 GAGGACTTTAAGTGCTGTTAGGG + Intronic
909011436 1:70339489-70339511 TTGGATTTTTAGTAGAGATAAGG + Intronic
909049637 1:70752764-70752786 GTGGATGTTAATCACAGTGAGGG + Intergenic
909221501 1:72968268-72968290 TTGGATTTTAAGTTCAGCTTTGG - Intergenic
909371601 1:74889122-74889144 GTGTGTTTGAAGTACAGTGATGG - Intergenic
909707002 1:78597375-78597397 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
909797326 1:79757554-79757576 TTGTATTTTTAGTACAGATAGGG + Intergenic
911513083 1:98831794-98831816 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
915993976 1:160545802-160545824 TTGTATTTTAAGTACAGATGGGG + Intronic
916161284 1:161917592-161917614 TTGTATTTTCAGTAGAGTTAGGG + Intronic
917097809 1:171417102-171417124 GTAGATTTTAAGATCAGGTAGGG - Intergenic
917168684 1:172144642-172144664 GAGGATTTTAAGTACATAGAAGG - Intronic
918057076 1:181031355-181031377 TTGTATTTTTAGTACAGATAGGG + Intergenic
923128560 1:231054866-231054888 TTGTATTTTTAGTACAGATAGGG + Intergenic
923813213 1:237343993-237344015 GTGTATTTTTAGTACAGATGGGG + Intronic
924513706 1:244749234-244749256 TTGTATTTTTAGTACAGATAGGG - Intergenic
924584039 1:245346115-245346137 GTGTATTTTTAGTAGAGTCAGGG + Intronic
924672529 1:246144053-246144075 GTAGCTTATAAGTACAGTCAGGG - Intronic
1062997983 10:1885362-1885384 TTGTATTTTTAGTACAGATAGGG - Intergenic
1064265798 10:13824301-13824323 TTGTATTTTTAGTACAGATAGGG - Intronic
1064579885 10:16783526-16783548 GTGTATTTTTAGTACAGATGGGG + Intronic
1064961269 10:20967453-20967475 TTGTATTTTGAGTACAGCTAGGG - Intronic
1064999808 10:21328217-21328239 GTGTATTTTTAGTAGAGTTGGGG + Intergenic
1065000528 10:21333950-21333972 TTGTATTTTTAGTACAGATAGGG + Intergenic
1065336690 10:24659485-24659507 TTGGATTTTTAGTAGAGATAGGG + Intronic
1065529567 10:26654509-26654531 TTGTATTTTTAGTACAGATAGGG - Intergenic
1065557375 10:26930416-26930438 TTGTATTTTTAGTACAGATAGGG + Intergenic
1066328135 10:34387024-34387046 GTGGCTTTTAACTACAGCTGTGG - Intronic
1066342366 10:34548314-34548336 GTGTGTTTTTAGTAGAGTTAGGG - Intronic
1066570128 10:36762455-36762477 TTGTATTTTTAGTACAGATAGGG + Intergenic
1066688693 10:38005394-38005416 GTGTATTTTTAGTAGAGATAGGG - Intergenic
1070029834 10:72666323-72666345 CTGTATTTTTAGTACAGATAGGG - Intergenic
1070375010 10:75821593-75821615 TTGTATTTTTAGTACAGATAGGG - Intronic
1070448512 10:76532947-76532969 GTGGATTTTATGTTAAATTATGG + Intronic
1070557623 10:77540826-77540848 GTGTATTTTTAGTAGAGTTGGGG - Intronic
1070574776 10:77669731-77669753 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1071343934 10:84673700-84673722 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1071594490 10:86909417-86909439 TTGTATTTTTAGTAGAGTTAAGG - Intronic
1071977767 10:90971937-90971959 GTGGAGTTGAAGGACAGTTCAGG + Intergenic
1072075170 10:91963929-91963951 GTCAATTTTGAGTAAAGTTAAGG - Intronic
1072225958 10:93369046-93369068 ATGGATTTTAAGCTCAGTGAAGG + Intronic
1072266403 10:93732494-93732516 GCGTATTTTCAGTACAGTTGGGG + Intergenic
1072495858 10:95958317-95958339 TTGTATTTTTAGTACAGTTGGGG - Intronic
1073090814 10:100937437-100937459 GCAGATTTTAAGTACATTGATGG + Exonic
1074562582 10:114547180-114547202 GTGGATAATAGCTACAGTTAAGG - Intronic
1075019963 10:118944545-118944567 TTGGATTTTTAGTAGAGATAGGG - Intergenic
1075042467 10:119119174-119119196 GTGTATTTTTAGTACAGATGGGG + Intronic
1075187444 10:120275842-120275864 CAAGCTTTTAAGTACAGTTAGGG + Intergenic
1075891923 10:125959222-125959244 GTGGATTTTTAGTAGAGGCAGGG - Intronic
1077848258 11:6048993-6049015 TTGTATTTTTAGTACAGATAGGG + Intergenic
1078756955 11:14220141-14220163 GTGGACTTTATGTAAACTTATGG - Intronic
1079067630 11:17310462-17310484 TTGTATTTTAAGTACAGACAGGG - Intronic
1079789363 11:24716721-24716743 TTGTATTTTTAGTACAGATAGGG - Intronic
1080534550 11:33208723-33208745 TTGTATTTTTAGTACAGATAGGG + Intergenic
1080611516 11:33908160-33908182 TTGTATTTTTAGTACAGATAGGG - Intergenic
1081137773 11:39460372-39460394 TTGTATTTTTAGTACAGATAGGG - Intergenic
1081215786 11:40395812-40395834 TTGTATTTTTAGTACAGATAAGG - Intronic
1081826608 11:46059913-46059935 GGGGATTTTTAGTACAGATGGGG + Intronic
1083450944 11:62744738-62744760 CTGTATTTTCAGTACAGTCAGGG - Intergenic
1083839130 11:65293435-65293457 TTGTATTTTTAGTACAGATAGGG - Intronic
1084282143 11:68104593-68104615 TTGTATTTTTAGTACAGATAGGG + Intronic
1084663327 11:70560042-70560064 TTGGATTTTTAGTAGAGATAGGG + Intronic
1086316606 11:85601511-85601533 GTGTATTTTTAGTACAGACAGGG + Intronic
1087124809 11:94614479-94614501 GTGTATTTTTAGTAGAGTCAGGG + Intronic
1087854988 11:103080836-103080858 GTGTATTTTAAGTAGAGACAGGG - Intronic
1088472553 11:110201951-110201973 GTGTGTTTTCAGTAGAGTTAAGG + Intronic
1088789960 11:113215863-113215885 GTGGATTTAATGTACATTTCAGG + Intronic
1089123659 11:116160946-116160968 CTGGCTTTTAAGTTCAATTAGGG + Intergenic
1089597989 11:119594132-119594154 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1090405543 11:126473974-126473996 TTGTATTTTAAGTAGAGTTGGGG + Intronic
1090827526 11:130398244-130398266 TTGTATTTTTAGTACAGATAAGG - Intergenic
1092339748 12:7665468-7665490 TTGTATTTTTAGTACAGATAGGG + Intronic
1092481512 12:8863276-8863298 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1092797782 12:12130356-12130378 TTGTATTTTTAGTACAGCTAGGG + Intronic
1093534535 12:20208073-20208095 TTGGATTTTAAGTAGAGACAGGG - Intergenic
1094030656 12:26008097-26008119 GTGTATTTTTAGTACAGACAGGG - Intronic
1094163594 12:27418803-27418825 TTGTATTTTCAGTACAGATAGGG - Intronic
1094305496 12:29014948-29014970 ATGCATTTTAAGGTCAGTTATGG - Intergenic
1094436904 12:30430733-30430755 TTGTATTTTAAGTAGAGTCAGGG + Intergenic
1095212344 12:39509113-39509135 GTGGCTTATAAGGACAGTTCAGG + Intergenic
1095723749 12:45429576-45429598 GTGGTTTTTAAGCACACTGAGGG - Exonic
1095896722 12:47287421-47287443 GTGTATTTTTAGTACAGACAGGG + Intergenic
1096172842 12:49487316-49487338 TTGTATTTTTAGTACAGATAGGG - Intronic
1096767474 12:53904556-53904578 TTGGATTTTTAGTACAGACAGGG - Intergenic
1096896778 12:54829028-54829050 TTGTATTTTTAGTACAGATAGGG + Intergenic
1097122980 12:56750326-56750348 CTGGATTTTAGATACACTTATGG + Intronic
1097292537 12:57930444-57930466 TTGTATTTTTAGTACAGTTGCGG + Intergenic
1097662805 12:62449090-62449112 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
1098491548 12:71086882-71086904 TTGGATTTTTAGTAGAGTTGGGG + Intronic
1099121250 12:78691699-78691721 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1099281533 12:80654673-80654695 TTGGATTTTTAGTACAGATGGGG - Intronic
1099393663 12:82111452-82111474 TTGTATTTTTAGTACAGATAGGG - Intergenic
1099842891 12:87988799-87988821 GTGGATTTTAAGTACAGTTAAGG + Intronic
1100302347 12:93319546-93319568 GTTGATTCAAAGTATAGTTAGGG - Intergenic
1100840500 12:98607828-98607850 TTGTATTTTTAGTACAGATAGGG + Intergenic
1101133426 12:101713067-101713089 CTGGATTTTAAGTTTTGTTAGGG + Intronic
1101149639 12:101872686-101872708 TTGGATTTTTAGTAGAGATAGGG - Intergenic
1101664163 12:106794803-106794825 GTGGATTCAAAGTACTGTTTAGG - Intronic
1102719929 12:115007354-115007376 GTGTATTTTTAGTACAGATGGGG + Intergenic
1103275156 12:119705083-119705105 TTGTATTTTAAGTACAGATGGGG + Intronic
1103544190 12:121688091-121688113 GTAGATTTTGAGTCCATTTAAGG - Intergenic
1103580712 12:121913116-121913138 GTGTATTTTTAGTAGAGATAGGG + Intronic
1103667475 12:122581369-122581391 TTGTATTTTAAGTAGAGTTGGGG + Intronic
1103814602 12:123644001-123644023 TTGTATTTTAAGTAGAGATAGGG + Intronic
1104013614 12:124948572-124948594 TTGGATTTTTAGTAGAGCTAGGG - Intronic
1104075756 12:125388253-125388275 GTGTATTTTTAGTAGAGATAGGG - Intronic
1104260812 12:127180461-127180483 GAGGATTTTTAGGACAGTGAAGG - Intergenic
1104280693 12:127373965-127373987 GTGGATTTTAAGGTCTGTTTAGG + Intergenic
1104868972 12:131980725-131980747 TTGCATTTTAGGTACAGTTGTGG + Intronic
1105618847 13:22047467-22047489 GTTGACTTTAAGTACATTTATGG + Intergenic
1105878589 13:24583195-24583217 TTGGATTTTTAGTAGAGATAGGG - Intergenic
1106048956 13:26172715-26172737 CTGTATTTTTAGTACAGATAAGG + Intronic
1106474634 13:30088200-30088222 GTGGATTTTTATTAAACTTATGG - Intergenic
1106887945 13:34210361-34210383 GTAAATTTTAAAGACAGTTATGG - Intergenic
1106910053 13:34453928-34453950 GTGTATTTTTAGTAGAGATAGGG - Intergenic
1107027211 13:35814561-35814583 GAGGCTTTAAAATACAGTTATGG - Intronic
1107429637 13:40328665-40328687 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1107527954 13:41252050-41252072 TTGTATTTTTAGTACAGTCAGGG + Intronic
1108329516 13:49371360-49371382 TTGTATTTTTAGTACAGATAGGG + Intronic
1108354093 13:49614673-49614695 TTGTATTTTTAGTACAGTTGGGG - Intergenic
1108535562 13:51372938-51372960 TTTGATTCTGAGTACAGTTAAGG + Intronic
1109195753 13:59376272-59376294 GTGTATTTTTAGTACAGATGGGG + Intergenic
1110263225 13:73509781-73509803 GTAGCTTTTAAATACAATTATGG + Intergenic
1111296676 13:86288332-86288354 TTGTATTTTTAGTACAGATAGGG - Intergenic
1111779898 13:92709229-92709251 TTGGATTTTTAGTAGAGATAGGG + Intronic
1112562173 13:100524697-100524719 TTGTATTTTTAGTACAGATAGGG - Intronic
1113102894 13:106739249-106739271 GAGGATTTTAAGCCCAATTAAGG + Intergenic
1114802162 14:25789300-25789322 TTGTATTTTATGTACAGTCAGGG + Intergenic
1114855336 14:26432772-26432794 GTGCATTTTAAGTGCAATAAAGG + Intergenic
1114962578 14:27912213-27912235 GTGGATGTTGAGTAGAGTCATGG + Intergenic
1115114942 14:29869268-29869290 TTGTATTTTTAGTACAGATAGGG - Intronic
1115223225 14:31077906-31077928 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1115502905 14:34065160-34065182 TTGTATTTTTAGTACAGATAGGG + Intronic
1115565541 14:34622132-34622154 TTGTATTTTTAGTACAGTTGGGG + Intronic
1115636865 14:35298315-35298337 TTGTATTTTTAGTACAGATAGGG - Intronic
1115960721 14:38834408-38834430 TTGTATTTTTAGTACAGATAGGG - Intergenic
1116455571 14:45117142-45117164 GTGTATTTTTAGTAGAGGTAGGG + Intronic
1116712554 14:48386767-48386789 GTTGATTTCAAGTAAGGTTAAGG - Intergenic
1116873920 14:50092778-50092800 TTGTATTTTTAGTACAGTCAGGG - Intergenic
1116948674 14:50859110-50859132 GTGGATTTTAAATACGCATATGG + Intronic
1117346991 14:54842497-54842519 CTGGAGTTTAAGTACAGTGATGG - Exonic
1117591484 14:57273110-57273132 GTGTATTTTTAGTAAAGTCAGGG + Intronic
1117680424 14:58198010-58198032 TTGGATTTTTAGTAAAGATAGGG - Intronic
1117929405 14:60823982-60824004 TTGTATTTTTAGTACAGATAGGG - Intronic
1118266412 14:64298805-64298827 GTGGAATTTAAGTACCTTTGAGG - Intronic
1118288038 14:64495242-64495264 TTGGAGTTTAAGTCCAGCTAAGG - Intronic
1119127957 14:72145653-72145675 GTGGATTTTTAGTAGAGATGGGG + Intronic
1119314612 14:73682359-73682381 TTGTATTTTTAGTACAGATAGGG + Intronic
1119914900 14:78389226-78389248 CTGTATTTTTAGTACAGTCAGGG + Intronic
1120081238 14:80218803-80218825 TTGTATTTTAAGTACAGATGGGG - Intronic
1120102394 14:80460555-80460577 TTGTATTTTAAGTAGAGTCAGGG + Intergenic
1120651872 14:87143982-87144004 CTGGATTTTAAGTTCAGTACAGG + Intergenic
1121362233 14:93272142-93272164 GTAGATTTTTAGTACAGATGGGG - Intronic
1121630121 14:95415820-95415842 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1122648135 14:103208274-103208296 TTGTATTTTAAGTACAGCTGGGG + Intergenic
1124204895 15:27709081-27709103 GTGAATTTTCATTTCAGTTATGG + Intergenic
1124612486 15:31217645-31217667 TTGTATTTTAAGTAGAGATAGGG + Intergenic
1124947071 15:34278741-34278763 TTGTATTTTTAGTACAGTTGGGG + Intronic
1125034863 15:35111818-35111840 GTAGATTTTTAGTAGAGTCAGGG - Intergenic
1125653282 15:41334718-41334740 GTGTATTTTTAGTAGAGATAGGG + Intronic
1125794990 15:42397465-42397487 GTGTATTTTTAGTACAGACAGGG - Intronic
1125812891 15:42556830-42556852 TTGTATTTTTAGTACAGTTGGGG - Intronic
1126136751 15:45400047-45400069 TTGGATTTTTAGTAGAGATAGGG - Intronic
1126714725 15:51502493-51502515 GTGTATTTTTAGTACAGACATGG + Intronic
1126880139 15:53085522-53085544 GTGTATTTTAAGTAGAGATGGGG + Intergenic
1127267334 15:57372814-57372836 TTGTATTTTTAGTACAGATAGGG + Intergenic
1127406979 15:58659904-58659926 GTGGATTTTTAGTAGAGACAGGG + Intronic
1127429907 15:58894875-58894897 TTGTATTTTTAGTACAGATAGGG + Intronic
1127948867 15:63784781-63784803 TTGTATTTTCAGTACAGTTGGGG + Intronic
1128598980 15:68979418-68979440 GTGGGTCTTAAGTATAGCTAGGG - Intronic
1128642088 15:69346992-69347014 GTGTATTTTTAGTACAGATGAGG + Intronic
1128877956 15:71217442-71217464 GTGTATTTTTAGTACAGATGGGG - Intronic
1129743567 15:78002354-78002376 GTGTATTTTGAGTACAGATGGGG + Intronic
1129997623 15:80020473-80020495 CTGTATTTTTAGTACAGATAGGG - Intergenic
1130180392 15:81621220-81621242 TTGTATTTTAAGTACAGATGGGG + Intergenic
1130208880 15:81904337-81904359 TTGTATTTTTAGTACAGATAGGG + Intergenic
1131133718 15:89916739-89916761 TTTGATTTTGACTACAGTTAAGG - Intergenic
1132256331 15:100379668-100379690 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1132834987 16:1948396-1948418 TTGTATTTTTAGTACAGTTGGGG + Intronic
1133275406 16:4635237-4635259 TTGGATTTTTAGTAGAGATAGGG - Intronic
1133353604 16:5119613-5119635 TTGTATTTTTAGTACAGTTGGGG + Intergenic
1133559604 16:6938757-6938779 TTGGATTTTTAGTACAGACAGGG - Intronic
1133907360 16:10034350-10034372 TTGGATTTTTAGTAGAGATAGGG - Intronic
1134174405 16:11994189-11994211 GAGGATTCTGAGTAGAGTTAGGG + Intronic
1135006507 16:18828420-18828442 GAAGATGTTAACTACAGTTAAGG + Intronic
1136480489 16:30538756-30538778 TTGGATTTTTAGTAGAGATAGGG + Intronic
1137263683 16:46851700-46851722 GTGTATTTTTAGTAGAGTTGGGG + Intergenic
1137640938 16:50028131-50028153 GTGTATTTTTAGTAGAGATAGGG + Intronic
1138545403 16:57716328-57716350 GTGTATTTTTAGTAGAGATAGGG - Intronic
1139901557 16:70332471-70332493 TTGTATTTTCAGTACAGATAGGG + Intronic
1140433739 16:74927413-74927435 GTGTATTTTTAGTAGAGTTGGGG - Intronic
1140508403 16:75489224-75489246 TTGTATTTTTAGTACAGTTGGGG - Intronic
1141369168 16:83471446-83471468 TTGTATTTTTAGTACAGATAGGG + Intronic
1141584219 16:85022346-85022368 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1141887477 16:86902435-86902457 GTGTATTTTTAGTACAGACAAGG + Intergenic
1142833171 17:2564456-2564478 GTGTATTTTTAGTACAGATGGGG + Intergenic
1142838143 17:2604636-2604658 GTGTATTTTTAGTAGAGATAGGG - Intronic
1143231104 17:5356181-5356203 GTGTATTTTTAGTAGAGATAGGG - Intronic
1143839664 17:9721911-9721933 TTGTATTTTTAGTACAGATAGGG + Intronic
1144098172 17:11920446-11920468 GTGTATTTTTAGTAGAGATAGGG - Intronic
1144418791 17:15076475-15076497 TTGTATTTTTAGTACAGATAGGG - Intergenic
1145725975 17:27124771-27124793 TTGTATTTTAAGTACAGATGGGG - Intergenic
1146178441 17:30681717-30681739 TTGTATTTTTAGTACAGATAGGG - Intergenic
1146498945 17:33347927-33347949 TTGTATTTTTAGTACAGATAGGG - Intronic
1147212231 17:38878383-38878405 GTGCATTTAAAGTACAGATGAGG + Intronic
1147782183 17:42951377-42951399 TTGTATTTTTAGTACAGATAGGG - Intronic
1147972461 17:44226601-44226623 TTGTATTTTTAGTACAGATAGGG - Intergenic
1148910795 17:50941495-50941517 TTGTATTTTAAGTACAGACAGGG - Intergenic
1149824948 17:59819624-59819646 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1153843390 18:9027106-9027128 TTGTATTTTTAGTACAGTTGGGG - Intergenic
1154052263 18:10972118-10972140 GTGTATTTTTAGTAGAGATAGGG - Intronic
1155057164 18:22194991-22195013 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1155111423 18:22718654-22718676 CTGGAATTTAGGAACAGTTAAGG - Intergenic
1157090721 18:44633682-44633704 GTGGATTTTTAGTAGAGATATGG + Intergenic
1157772520 18:50361846-50361868 TTGTATTTTTAGTACAGATAGGG + Intergenic
1158328519 18:56336357-56336379 GTGCATTTTTAGTAGAGATAGGG + Intergenic
1158351659 18:56570544-56570566 TTGTATTTTTAGTACAGTTGGGG - Intergenic
1158715415 18:59874933-59874955 TTGTATTTTTAGTACAGATAGGG - Intergenic
1158991593 18:62874333-62874355 GTGTATTTTTAGTAGAGATAGGG - Intronic
1159361248 18:67406201-67406223 TTGGATTTTTAGTACATTTAAGG + Intergenic
1159825292 18:73201507-73201529 GTGTATTTCATGTATAGTTAGGG + Intronic
1160206218 18:76835758-76835780 GCTGATTTTAAGTACATTTAAGG + Intronic
1160902794 19:1437167-1437189 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
1161207509 19:3048984-3049006 TTGGATTTTTAGTAGAGATAGGG + Intergenic
1161492917 19:4572111-4572133 TTGTATTTTTAGTACAGTTGGGG + Intergenic
1162334775 19:10053578-10053600 TTGGATTTTTAGTACAGATGGGG + Intergenic
1162400350 19:10442349-10442371 TTGAATTTTTAGTACAGTCAGGG - Intronic
1163125450 19:15241983-15242005 TTGTATTTTTAGTACAGATAGGG + Intronic
1163506795 19:17712321-17712343 TTGTATTTTTAGTACAGATACGG + Intergenic
1164106339 19:22109178-22109200 GTGTATTTTTAGTAGAGTCAGGG - Intergenic
1164270172 19:23665669-23665691 GTGTATTTTAAGTAGAGGCAGGG + Intronic
1164283481 19:23789848-23789870 TTGTATTTTTAGTACAGATAGGG + Intronic
1164433194 19:28206348-28206370 GTGGATTTTTAGTAAAATTCAGG + Intergenic
1164551656 19:29217367-29217389 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
1165489965 19:36117522-36117544 TTGTATTTTAAGTAGAGTTGGGG + Intronic
1165683472 19:37797435-37797457 TTGTATTTTTAGTACAGATAGGG - Intronic
1165927216 19:39334438-39334460 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1166158350 19:40932638-40932660 GTGTTTTTTTAGTACAGATAGGG - Intergenic
1166819175 19:45566320-45566342 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1167003799 19:46762249-46762271 GTGTATTTTAAGTAGAGATGGGG + Intronic
1167111177 19:47462434-47462456 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1167897827 19:52595442-52595464 TTGTATTTTTAGTACAGATAGGG + Intronic
1167989824 19:53349030-53349052 TTGCATTTTTAGTAGAGTTAGGG + Intronic
1167993314 19:53379288-53379310 TTGTATTTTTAGTAGAGTTATGG + Intronic
1168205188 19:54845257-54845279 TTGTATTTTTAGTACAGATAGGG - Intronic
1168525560 19:57085910-57085932 GTGTATTTTTAGTAGAGGTAGGG + Intergenic
926207394 2:10843642-10843664 GTGCATATTCAGTACAGTCAGGG + Intergenic
926859008 2:17288941-17288963 GTGGATTTTTAGGGCAGTGAAGG - Intergenic
928800045 2:35078435-35078457 GTGGATTATAACTACTATTAAGG - Intergenic
928820301 2:35353966-35353988 GTGGATTTTAAGCACATTAAAGG + Intergenic
928824119 2:35398198-35398220 TTGTATTTTTAGTACAGATAGGG + Intergenic
928832979 2:35511181-35511203 GGGGATCTTAAATACAGTTCTGG - Intergenic
928912519 2:36437199-36437221 TTGTATTTTTAGTACAGATACGG - Intronic
930044067 2:47153578-47153600 TTGTATTTTTAGTACAGATAGGG - Intronic
930320187 2:49844241-49844263 CTGTATTTTTAGTACAGATAGGG - Intergenic
930572322 2:53102606-53102628 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
931286360 2:60835172-60835194 TTGTATTTTTAGTACAGTTGGGG - Intergenic
931783928 2:65602216-65602238 TTGTATTTTTAGTACAGATAGGG - Intergenic
931920221 2:67007361-67007383 CTGCATTTTAAGTACTATTAAGG - Intergenic
933707362 2:85301951-85301973 TTGTATTTTTAGTACAGATAGGG - Intronic
933948788 2:87310479-87310501 GTTGAATTTAAGTACTGTAAGGG + Intergenic
934100412 2:88648001-88648023 TTGTATTTTTAGTACAGATAGGG - Intergenic
934665779 2:96169203-96169225 GTGGTTTTTAAGCACATTTACGG - Intergenic
934732530 2:96668671-96668693 GGAGATTTTAAGAACAGGTAGGG - Intergenic
935201495 2:100860698-100860720 GTGGATTATAATTACAGTTTGGG + Intronic
935472688 2:103479076-103479098 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
935604089 2:104952555-104952577 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
936331409 2:111551117-111551139 GTTGAATTTAAGTACTGTAAGGG - Intergenic
937603552 2:123769545-123769567 GTGTATTTTTAGTAGAGATAGGG + Intergenic
938578199 2:132622937-132622959 GTGTATTTTTAGTACAGACAGGG - Intronic
938605455 2:132888131-132888153 GTGTATTTTAACTATAGCTATGG + Intronic
938860373 2:135362022-135362044 TTGTATTTTAAGTAGAGATAAGG - Intronic
939831148 2:147072560-147072582 TTGTATTTTTAGTACAGATAGGG + Intergenic
940040750 2:149357956-149357978 TTGGATTTTTAGTAGAGATAGGG + Intronic
940474489 2:154144962-154144984 TTATATTTTAAGTACAATTAAGG + Intronic
940914259 2:159237346-159237368 GTGTATTTTTAGTAGAGGTAGGG - Intronic
941919399 2:170834249-170834271 GTGGAATTTAAGCATAGATAAGG + Intronic
942046323 2:172101354-172101376 GTTCATTTTAAGTACTTTTAAGG - Intronic
943203712 2:184862430-184862452 GTTGATGTTAAGTGCAATTAAGG - Intronic
943416406 2:187611381-187611403 TTGTATTTTTAGTACAGATAGGG - Intergenic
943456570 2:188115290-188115312 TTGTATTTTTAGTACAGATAGGG + Intergenic
943966294 2:194338155-194338177 CTGGATTTTAAATACATTGATGG - Intergenic
944186035 2:196949910-196949932 TTGTATTTTTAGTACAGTTGGGG + Intergenic
945240621 2:207673176-207673198 TTGTATTTTTAGTACAGTCAGGG + Intergenic
945797497 2:214383107-214383129 TTGGATTATAAGTTCAGTGAAGG - Intronic
947046629 2:225994472-225994494 GTGTATTTTTAGTAGAGTTGGGG - Intergenic
947096292 2:226570741-226570763 ATGGATTTTCACTACTGTTACGG - Intergenic
947583873 2:231339757-231339779 TTGTATTTTAAGTAGAGATACGG - Intronic
947622028 2:231596991-231597013 TTGTATTTTTAGTACAGTTGGGG + Intergenic
948091459 2:235299669-235299691 TTGTATTTTTAGTACAGATAGGG + Intergenic
948133860 2:235621192-235621214 TTGTATTTTTAGTACAGATAGGG + Intronic
948203715 2:236149317-236149339 TTGTATTTTTAGTACAGATAGGG + Intergenic
1169282940 20:4282391-4282413 GTGGATTTTTAGTACTAATAAGG - Intergenic
1170402140 20:15998736-15998758 TTGTATTTTTAGTACAGATAGGG + Intronic
1170503739 20:17002570-17002592 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1170680821 20:18523573-18523595 TTGTATTTTTAGTACAGATAGGG + Intronic
1172079421 20:32327926-32327948 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1172321323 20:33997285-33997307 TTGTATTTTTAGTACAGATAGGG + Intronic
1172575285 20:36003153-36003175 GTGTATATTAAGTAGAGTTGTGG - Intronic
1172816771 20:37693612-37693634 GTGTATTTTATTTACACTTATGG + Intergenic
1173238136 20:41267017-41267039 TTGGATTTTTAGTACAGATGGGG + Intronic
1174576297 20:51540183-51540205 GTGTATTTTTAGTAGAGTTGGGG + Intronic
1174596157 20:51685384-51685406 TTGGATTTTTAGTAGAGTTGGGG - Intronic
1174801947 20:53571576-53571598 GTGTATTTTTAGTACAGACAGGG + Intronic
1174816322 20:53690264-53690286 TTGTATTTTTAGTACAGATAGGG + Intergenic
1175094696 20:56532145-56532167 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1175857592 20:62130869-62130891 TTGGATTTTTAGTACAGATGGGG - Intronic
1176154552 20:63611880-63611902 GTAGATTTTTAGTACAGTGCTGG - Intronic
1176209803 20:63913750-63913772 TTGTATTTTTAGTACAGATAGGG + Intronic
1176741826 21:10611767-10611789 TTGTATTTTTAGTACAGATAGGG - Intergenic
1177158633 21:17524064-17524086 GTGTATTTTTAGTAGAGTTGGGG + Intronic
1177200574 21:17950559-17950581 GTGGATATAAAGTACAATAAAGG + Intronic
1177476129 21:21625868-21625890 GTGGATATTTATTGCAGTTAAGG + Intergenic
1177660065 21:24071083-24071105 GTGGAATTTAGGCACAGGTAAGG + Intergenic
1178272734 21:31207760-31207782 GTGTATTTTTAGTACAGATGGGG + Intronic
1178639722 21:34336226-34336248 TTGTATTTTTAGTACAGATAGGG + Intergenic
1178714243 21:34948926-34948948 GTGTATTTTAAGTAGAGACAGGG + Intronic
1179677574 21:42994212-42994234 TTGGATTTTTAGTAGAGATAAGG + Intronic
1181096740 22:20510211-20510233 TTGGATTTTTAGTAGAGATAGGG - Intronic
1181584899 22:23847787-23847809 TTGTATTTTTAGTACAGATAGGG - Intergenic
1182273279 22:29169346-29169368 TTGGATTTTTAGTAAAGATAGGG - Intergenic
1182853529 22:33497246-33497268 TTGTATTTTTAGTACAGATAGGG + Intronic
1182894270 22:33845940-33845962 GTGGATTTTAGATGAAGTTAAGG - Intronic
1183133876 22:35868036-35868058 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1183449432 22:37883739-37883761 GTGTATTTTTAGTACAGATGGGG - Intronic
1183779953 22:39993106-39993128 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
949397856 3:3634354-3634376 GTGTCTAATAAGTACAGTTAGGG + Intergenic
949679408 3:6495437-6495459 GTGTATTTGGAGTCCAGTTAAGG - Intergenic
950257376 3:11516908-11516930 GTGGATTTTTAGTACAGACGGGG - Intronic
951185192 3:19704570-19704592 TTGAATTTTTAGTACAGATAGGG + Intergenic
952239185 3:31512222-31512244 GTGTATTTTTAGTACAGACAGGG + Intergenic
952527311 3:34224157-34224179 GTGTATTTTTAGTACAGATGGGG + Intergenic
952776550 3:37052068-37052090 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
952854671 3:37759727-37759749 GTGTATTTTTAGTACAGACAGGG - Intronic
952907970 3:38155774-38155796 TTGTATTTTTAGTACAGTCAGGG + Intergenic
952973821 3:38676316-38676338 TTGTATTTTAAGTACAGACAGGG - Intergenic
953158209 3:40394292-40394314 CTGTATTTTTAGTACAGATAGGG + Intronic
953702705 3:45209284-45209306 TTGTATTTTTAGTACAGATAGGG + Intergenic
953765118 3:45734238-45734260 TTGTATTTTTAGTACAGATAGGG - Intronic
955388832 3:58503664-58503686 TTGTATTTTTAGTACAGATAGGG + Intergenic
956125562 3:66008067-66008089 GTGTATTTTTAGTACAGATGGGG + Intronic
956151484 3:66247624-66247646 ATGGACTTTAAATTCAGTTATGG + Intronic
956303784 3:67802354-67802376 GTGTATTTTTAGTAGAGATAGGG - Intergenic
956312338 3:67894998-67895020 GTGGATTTTTAGTAAAGATGCGG - Intergenic
956828010 3:73016997-73017019 TTGTATTTTTAGTACAGATAGGG + Intronic
956994029 3:74802790-74802812 GTGGAATTTAAGAACAGTCCTGG - Intergenic
957002407 3:74901434-74901456 TTGTATTTTAAGTAGAGTTGGGG - Intergenic
958795760 3:98704671-98704693 TTGTATTTTAAGTACAGATGGGG - Intergenic
959218688 3:103485948-103485970 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
959441940 3:106387599-106387621 TTGTATTTTAAGTACAGACAGGG - Intergenic
960222237 3:115127415-115127437 GTGTATTTTTAGTACAGACATGG - Intronic
961263889 3:125624779-125624801 GTGTATTTTAAGTAGAGACAGGG + Intergenic
961279539 3:125755099-125755121 GTGTATTTTTAGTACAGACAGGG - Intergenic
962132544 3:132697421-132697443 GTGGATTTTAAATTGTGTTATGG - Intronic
962651849 3:137502532-137502554 GTGTATTTTTAGTAGAGATATGG - Intergenic
962716042 3:138126955-138126977 TTGGATTTTTAGTAGAGATAGGG - Intronic
962976277 3:140448832-140448854 ATGGATTTTAAGTTTACTTATGG + Intronic
963502822 3:146149884-146149906 GTGGATTTTATGTAAATTGAAGG - Intronic
964378746 3:156074887-156074909 GTGCATTTTAACTCCAGTTTAGG + Intronic
964893730 3:161568744-161568766 GTGGATTTTATCTGTAGTTATGG + Intergenic
965790977 3:172387664-172387686 ATGAATTTTAAGTAGAGGTATGG - Intronic
965858645 3:173119913-173119935 TTGTATTTTTAGTACAGATAGGG - Intronic
967723792 3:192842838-192842860 GTGCATGTTAAGTGCAGTTAGGG + Intronic
967745515 3:193050524-193050546 TTGTATTTTTAGTACAGTTGAGG + Intergenic
968136354 3:196222460-196222482 TTGTATTTTAAGTAGAGATAGGG - Intronic
968617580 4:1585907-1585929 GTGTATTTTTAGTACAGACAGGG + Intergenic
969442164 4:7223868-7223890 GTGGCTGTTAAGTGCTGTTAAGG + Intronic
969894179 4:10287628-10287650 GTGTATTTTAAATACAATTTTGG + Intergenic
970167075 4:13250037-13250059 GTGGATTTTATATACAGAGATGG + Intergenic
970172541 4:13304210-13304232 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
970269260 4:14326089-14326111 ATGGATTTTAGGTACTCTTATGG + Intergenic
970295195 4:14622203-14622225 GTGGATTTAAAGGTCAGTTCAGG - Intergenic
970891959 4:21056654-21056676 GTGTATTAGAAGTACACTTACGG - Intronic
970937340 4:21588711-21588733 GTAGATTTCAATTACAGTTAGGG - Intronic
971596504 4:28535792-28535814 TTGTATTTTTAGTACAGATAGGG + Intergenic
972348941 4:38217938-38217960 GTGGATTTTCAGGACAGAAAAGG + Intergenic
974549702 4:63355268-63355290 GTGTATTTTTAGTAGAGATAAGG - Intergenic
975427942 4:74252460-74252482 ATGGATTTTAAGTATTTTTATGG + Intronic
976723251 4:88191060-88191082 GTGTATTTTTAGTACAGATGGGG - Intronic
976920558 4:90436993-90437015 TTGTATTTTTAGTAGAGTTAGGG + Intronic
977229745 4:94437776-94437798 TTGGATTTTTAGTAGAGATAGGG - Intergenic
978649784 4:110986841-110986863 GTGGATGTTAACTACATTTTTGG + Intergenic
978807583 4:112816836-112816858 TTGTATTTTTAGTACAGATAGGG - Intergenic
978957497 4:114632384-114632406 GTGGATTTTCAGAAAAATTATGG + Intronic
980554719 4:134388243-134388265 GTGAATATTAAGTTCTGTTATGG + Intergenic
981177547 4:141700089-141700111 TTGTATTTTTAGTACAGATAGGG + Intronic
982743665 4:159084067-159084089 GTGGATTTTTAGTAGAGACATGG - Intergenic
983133372 4:164050100-164050122 GTGTATTTTTAGTAGAGATAGGG - Intronic
983489953 4:168377116-168377138 TTGTATTTTTAGTACAGTTGAGG - Intronic
985688079 5:1292683-1292705 TTGTATTTTTAGTACAGATAGGG + Intronic
986532137 5:8748759-8748781 TTGGATTTTTAGTACAGATTGGG + Intergenic
987617396 5:20294138-20294160 GTGAGTTTTTAGTACGGTTAAGG + Intronic
989065508 5:37457266-37457288 TTGGATTTTTAGTAGAGATAGGG + Intronic
989501697 5:42176246-42176268 TTGGATTTTCAGTACAGACAGGG - Intergenic
990814051 5:59763561-59763583 TTGAATTTTAAGCACAGTTTTGG - Intronic
990961860 5:61402256-61402278 GAAAATTTTAAGTACATTTAGGG + Intronic
991728766 5:69562439-69562461 TTGTATTTTTAGTACAGTCAGGG - Intronic
991805196 5:70417588-70417610 TTGTATTTTTAGTACAGTCAGGG - Intergenic
991866188 5:71065434-71065456 TTGTATTTTTAGTACAGTCAGGG + Intronic
992111331 5:73497261-73497283 GTGAAGTTTTAGTACAGGTAAGG - Intergenic
992918001 5:81479461-81479483 GTGTATTTTTAGTAGAGATAGGG + Intronic
993171565 5:84426314-84426336 TTGTATTTTTAGTACAGATAGGG - Intergenic
993509247 5:88751103-88751125 CTGGATTTAAAGAACATTTAAGG - Intronic
994133847 5:96262707-96262729 GTGTATTTTTAGTAGAGATAGGG + Intergenic
994419317 5:99513089-99513111 TTGGATTTTTAGTAGAGATAGGG + Intergenic
994669455 5:102749556-102749578 GTGGTTTTTATGTATAGTCAGGG - Intergenic
994960059 5:106588204-106588226 ATGGATTTTAAGTAGAATAAAGG - Intergenic
995195360 5:109360953-109360975 GTGTATTTTCAGTACAGACAGGG - Intronic
995235190 5:109820889-109820911 CTAGATTTTACGTAGAGTTAGGG + Intronic
995720518 5:115127386-115127408 TTGGATTTTTAGTAGAGATATGG - Intronic
996268865 5:121578290-121578312 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
996525563 5:124475593-124475615 GTGCATTTCAAGTACAGACAAGG - Intergenic
996736920 5:126766685-126766707 GTGGATTTTTAGTAGAGACAGGG + Intergenic
997549108 5:134737072-134737094 TTGTATTTTTAGTACAGTCAGGG + Intergenic
997938369 5:138134550-138134572 TTGGATTTTTAGTAGAGATAAGG + Intronic
998008503 5:138674025-138674047 GTGTATTTTTAGTAGAGTTGGGG - Intronic
998522689 5:142815211-142815233 GTGTATTTTTAGTAGAGATATGG + Intronic
998649820 5:144106047-144106069 GTGGCTTTTAAATCCATTTATGG - Intergenic
999145037 5:149386876-149386898 TTGAATTTTTAGTACAGATAGGG + Intronic
999215050 5:149926067-149926089 GTGTATTTTTAGTACAGATGGGG - Intronic
999595070 5:153194138-153194160 GTGTATTTTTAGTACAGACAGGG + Intergenic
999734586 5:154503397-154503419 TTGTATTTTTAGTACAGATAGGG - Intergenic
999742844 5:154569670-154569692 GTGGATATAAAGTAGAGCTATGG - Intergenic
999827110 5:155284204-155284226 ATGGATTTTAACTAAAGATAGGG - Intergenic
999993274 5:157068097-157068119 TTGTATTTTTAGTACAGTTGGGG - Intergenic
1000190723 5:158908156-158908178 GTGTATTTTAAGTAAAGATGAGG - Intronic
1000712881 5:164602242-164602264 TTGTATTTTTAGTAGAGTTAGGG - Intergenic
1000746225 5:165037341-165037363 GAGGAGTTTAAGTATAGTGAGGG - Intergenic
1001528414 5:172445380-172445402 GTGGATTTTTAGTAGAGATGAGG + Intronic
1002034919 5:176460776-176460798 TTGGATTTTTGGTACAGTTGGGG - Intronic
1002360546 5:178667229-178667251 GTGGTTTTTAAGGGAAGTTAGGG + Intergenic
1002694610 5:181076555-181076577 CTGTATTTTCAGTACAGATAGGG + Intergenic
1004391757 6:15215908-15215930 TTGGATTTTTAGTACAGATGGGG - Intergenic
1004416448 6:15428731-15428753 TTGTATTTTAAGTACAGACAAGG - Intronic
1004871901 6:19913523-19913545 GTGTATTTTTAGTACAGATGGGG - Intergenic
1004932474 6:20475672-20475694 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1005265161 6:24104610-24104632 TTGTATTTTTAGTACAGATAGGG - Intergenic
1005915576 6:30347976-30347998 TTGTATTTTAAGTACAGACAGGG - Intergenic
1006039269 6:31240360-31240382 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
1006525744 6:34603338-34603360 TTGTATTTTTAGTACAGATAGGG - Intronic
1006545679 6:34779350-34779372 GTGTATTTTTAGTAGAGTTGGGG + Intergenic
1006676124 6:35764945-35764967 TTGTATTTTAAGTACAGACAGGG - Intergenic
1006773181 6:36570936-36570958 TTGTATTTTAAGTACAGACAGGG + Intergenic
1006995054 6:38251716-38251738 GTGTATTTTTAGTAGAGATAGGG - Intronic
1007010494 6:38412684-38412706 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1007881387 6:45171888-45171910 TTGTATTTTAAGTACAGACAGGG + Intronic
1009506584 6:64489282-64489304 GTGGATTTTAACTGTGGTTAAGG + Intronic
1009596011 6:65737894-65737916 TTGTATTTTTAGTAAAGTTAGGG - Intergenic
1010125109 6:72422260-72422282 TTGGATTTTTATTATAGTTAGGG + Intergenic
1010255059 6:73748124-73748146 GTGGATTTGAAATATATTTAAGG - Intronic
1010546922 6:77170407-77170429 TTGGATTTTTAGTACAGACAGGG + Intergenic
1011322570 6:86113071-86113093 TTGGATTTTTAGTACAGATGGGG + Intergenic
1011591900 6:88977855-88977877 TTGTATTTTAAGTAGAGATAGGG - Intergenic
1012177240 6:96103177-96103199 GATGATTTTAAGTTCAGTCAGGG + Intronic
1013212089 6:107996156-107996178 GTGCATTTAAAGTACAGTCATGG + Intergenic
1014509796 6:122307162-122307184 GTGGCTTTGAAGTTCAGTAATGG + Intergenic
1014638372 6:123878052-123878074 TTGGATTTTAAGTAAAGGCAGGG - Intronic
1014673726 6:124339166-124339188 TTGTATTTTTAGTACAGATAGGG - Intronic
1015237622 6:130988914-130988936 TTGGATTTTTAGTAGAGATAGGG - Intronic
1015594021 6:134849288-134849310 TTGTATTTTTAGTACAGATAGGG + Intergenic
1015873179 6:137797510-137797532 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1016462144 6:144288077-144288099 GAGGAATTTGAGTACACTTAAGG - Intronic
1018508381 6:164495636-164495658 GTGTATTTAAAGAACAGTAATGG - Intergenic
1018559404 6:165085813-165085835 GTGGATTTTGGGTACTATTATGG + Intergenic
1018715791 6:166531812-166531834 CTGGATCTTAAATACACTTACGG + Intronic
1020254650 7:6496285-6496307 GTGTATTTTTAGTAGAGATATGG + Intergenic
1020610234 7:10387470-10387492 GTGGAGTTTAAGGACAGATGAGG + Intergenic
1021679651 7:23117258-23117280 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1023003468 7:35837894-35837916 GTGTATTTTTAGTAGAGATAGGG + Intronic
1023042572 7:36184901-36184923 TTGGATTTTTAGTAGAGATAAGG + Intronic
1023069365 7:36413816-36413838 TTGTATTTTTAGTACAGATAGGG - Intronic
1023430138 7:40082616-40082638 TTGTATTTTTAGTACAGCTAGGG - Intronic
1024170802 7:46783700-46783722 GTGGATTTTTAGTAGAGATGAGG - Intergenic
1024593487 7:50911831-50911853 TTGTATTTTTAGTACAGATAGGG - Intergenic
1025924209 7:65943619-65943641 TTGCATTTTTAGTACAGTTGGGG - Intronic
1026008254 7:66616366-66616388 GTGTATTTTTAGTAGAGATAGGG - Intergenic
1026039103 7:66851985-66852007 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
1026414571 7:70164996-70165018 GTGGAATTTTAGTAGAGTGATGG + Intronic
1026534171 7:71226650-71226672 TTGTATTTTTAGTACAGATACGG + Intronic
1026832268 7:73617534-73617556 GTGGATTTGATGGACAGCTAGGG - Intronic
1027115621 7:75477408-75477430 TTGGATTTTTAGTAGAGATAGGG - Intronic
1029225541 7:99025412-99025434 TTGTATTTTTAGTACAGATAAGG + Intergenic
1029241967 7:99169445-99169467 TTGTATTTTTAGTACAGATAGGG - Intergenic
1030026838 7:105332589-105332611 TTGTATTTTTAGTACAGATAGGG - Intronic
1030195240 7:106846700-106846722 TTGTATTTTAAGTAGAGATAGGG - Intergenic
1030740151 7:113099903-113099925 GTGCATTTTTAGATCAGTTACGG - Intergenic
1030930239 7:115514149-115514171 GTGGAATTTAAGGACAGCCAGGG + Intergenic
1031357159 7:120800960-120800982 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1031521635 7:122773770-122773792 GATAATTTGAAGTACAGTTATGG - Intronic
1031654359 7:124334082-124334104 AGGAATTTAAAGTACAGTTAAGG - Intergenic
1033088290 7:138362308-138362330 TTGTATTTTAAGTAGAGATAGGG - Intergenic
1033212980 7:139474196-139474218 GTGTATTTTTAGTAGAGATAGGG + Intronic
1033337857 7:140468526-140468548 TTGCATTTTTAGTAGAGTTAGGG - Intronic
1033414051 7:141146877-141146899 GAGGATTTTAAGGTTAGTTATGG + Intronic
1033649348 7:143329138-143329160 TTGTATTTTTAGTAGAGTTAGGG + Intronic
1035868534 8:3111657-3111679 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1036115038 8:5949966-5949988 GTGTATTTTTAGTACAGATGGGG + Intergenic
1036456996 8:8918359-8918381 TTGGATTTTTAGTAGAGTTGGGG - Intergenic
1037592156 8:20322091-20322113 GTGTATTTTTAGTACAGACAGGG + Intergenic
1037976387 8:23216567-23216589 TTGTATTTTTAGTACAGATAGGG - Intronic
1038526119 8:28275002-28275024 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1038602742 8:28963154-28963176 TTGTATTTTTAGTACAGTTGGGG + Intronic
1038791795 8:30674727-30674749 GTGTATTTTTAGTACAGACAGGG + Intergenic
1038823404 8:30974403-30974425 TTGTATTTTTAGTACAGATAGGG - Intergenic
1040000404 8:42571073-42571095 TTGTATTTTTAGTACAGATAGGG + Intergenic
1040438280 8:47415075-47415097 TTGTATTTTTAGTACAGATAGGG + Intronic
1041803579 8:61825498-61825520 GTGGATTTAAAGTCCAGACATGG - Intergenic
1042808640 8:72799571-72799593 GTGGATTTTAAGAAAGGGTAGGG + Intronic
1044422267 8:92010916-92010938 GTGCTTTTTTAGTACATTTAGGG - Intronic
1045131345 8:99157665-99157687 TTTGATTTAAAGTAGAGTTATGG - Intronic
1046951499 8:120024061-120024083 TTGTATTTTTAGTACAGATAGGG - Intronic
1047158048 8:122343989-122344011 GAGCATTTTCAGTACAGTTACGG + Intergenic
1047346321 8:124032250-124032272 TTGGATTTTTAGTAGAGATAGGG - Intronic
1047714794 8:127585643-127585665 TTGGATTTTTAGTAGAGTCAGGG - Intergenic
1047863948 8:129001089-129001111 GTGTATTTTTAGTACAGATGGGG - Intergenic
1047973544 8:130107719-130107741 GTGTATTTTTAGTAGAGATAGGG + Intronic
1048459270 8:134606540-134606562 TTGGATTTTCAGTAGAGTTGGGG - Intronic
1048750564 8:137669260-137669282 TTGGATTTTTAGTAGAGATAGGG - Intergenic
1049122253 8:140749466-140749488 GTTGATTTTTAGTTCAGTTTGGG - Intronic
1050599677 9:7237909-7237931 GTGGGTTTTTATTACAGCTAAGG - Intergenic
1051503048 9:17798815-17798837 TTGTATTTTTAGTACAGATAGGG - Intergenic
1052077600 9:24162143-24162165 TTGTATTTTTAGTACAGATAGGG + Intergenic
1052873476 9:33532058-33532080 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1053408398 9:37898236-37898258 TTGTATTTTTAGTACAGATAGGG - Intronic
1053502619 9:38612689-38612711 TTGTATTTTTAGTAGAGTTAGGG + Intergenic
1055069514 9:72151776-72151798 TTGTATTTTAAGTAGAGTTGGGG + Intronic
1055283372 9:74700288-74700310 GAGGATTTTAAGAACAGGGATGG + Intergenic
1055683973 9:78750380-78750402 TTGGATTTTAACTACACTTTAGG - Intergenic
1055898765 9:81210803-81210825 GTGTATTTTTAGTAGAGATAGGG - Intergenic
1055938332 9:81624089-81624111 GTGGATTTTAAGTAAGTTTTTGG - Intronic
1056212199 9:84375317-84375339 TTGTATTTTTAGTACAGATAGGG + Intergenic
1056790053 9:89619447-89619469 TTGGATTTTTAGTAGAGTTGGGG - Intergenic
1057102574 9:92376866-92376888 GTGTATTTTTAGTACAGACAGGG - Intronic
1057596883 9:96422180-96422202 TTGGATTTTTAGTAGAGATAGGG - Intergenic
1057720937 9:97531436-97531458 TTGTATTTTAAGTAGAGATAGGG - Intronic
1057764290 9:97902472-97902494 TTGTATTTTAAGTAGAGGTAGGG + Intergenic
1057777915 9:98025849-98025871 GTGTATTTTTAGTACAGACAAGG - Intergenic
1058685201 9:107474150-107474172 TTGTATTTTAAGTACAGATAGGG + Intergenic
1059070803 9:111133947-111133969 GTGGCTTTTACTTACAGTAATGG - Intergenic
1059496446 9:114713637-114713659 GTGGATTTTATTAAAAGTTACGG + Intergenic
1059721888 9:116967976-116967998 GTAGAATTGTAGTACAGTTAAGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060691219 9:125662507-125662529 GTGTATTTTAAGTAGAGACAGGG - Intronic
1061431193 9:130532467-130532489 TTGGATTTTTAGTAGAGATAGGG + Intergenic
1061991397 9:134160848-134160870 GTGTATTTTTAGTAGAGTTGGGG + Intergenic
1185472334 X:391560-391582 TTGGATTTTTAGTACAGATGGGG - Intergenic
1185515785 X:697966-697988 GTGTATTTTTAGTACAGACAGGG - Intergenic
1185546645 X:951068-951090 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1185588126 X:1255642-1255664 TTGTATTTTTAGTACAGATAGGG + Intergenic
1185805685 X:3055033-3055055 TTGGATTTTAAGTGCAGTTTTGG - Intronic
1186275533 X:7934492-7934514 GTGTATTTTAAGTAGAGATGGGG - Intergenic
1189512799 X:41680307-41680329 TTGTATTTTTAGTAGAGTTAGGG - Intronic
1190003105 X:46708353-46708375 TTGTATTTTTAGTACAGCTAGGG - Intronic
1192748557 X:73964224-73964246 GTGTATTTTTAGTAGAGTCAGGG + Intergenic
1194062377 X:89220159-89220181 GTGGTTTTTAAGTTCATTTTAGG + Intergenic
1194453002 X:94067968-94067990 GAACAATTTAAGTACAGTTAAGG - Intergenic
1196018968 X:110969471-110969493 TTGGATTTTTAGTAGAGATAGGG + Intronic
1196397966 X:115286431-115286453 GTGTATTTTTGGTACAGTTGGGG + Intergenic
1197229725 X:123991076-123991098 GTGAATTTAAAGTATAGTGAAGG - Intronic
1197320877 X:125029246-125029268 GTGGTTTTTAAATAAATTTAAGG - Intergenic
1197580398 X:128275766-128275788 GTGTATTTTTAGTAGAGATAGGG + Intergenic
1197947928 X:131860655-131860677 TTGGATATTAAGTACGGTTGAGG - Intergenic
1198871697 X:141182679-141182701 GTGGATCATAAATTCAGTTAGGG - Intergenic
1198889736 X:141380318-141380340 TTGGATTTTTAGTAGAGATAGGG - Intergenic
1200048278 X:153414095-153414117 GTGAACTTTCAGTACTGTTATGG + Intergenic
1200716246 Y:6549125-6549147 GTGGTTTTTAAGTTCATTTTAGG + Intergenic
1200800898 Y:7386401-7386423 GTGGATAATAAGTCCAGTTTTGG + Intergenic
1201055493 Y:9985998-9986020 TTGGATTTTTAGTACAGATGGGG + Intergenic
1201273351 Y:12276957-12276979 TTGGATTTTAAGTGCAGTTTTGG + Intergenic
1201780793 Y:17720158-17720180 GTGTATTTTTAGTACAGATGGGG - Intergenic
1201820760 Y:18185832-18185854 GTGTATTTTTAGTACAGATGGGG + Intergenic