ID: 1099844636

View in Genome Browser
Species Human (GRCh38)
Location 12:88014195-88014217
Sequence AGATCAGGAGGTCTGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099844633_1099844636 -5 Left 1099844633 12:88014177-88014199 CCTCAGAAGGCAGAAGACAGATC 0: 1
1: 0
2: 3
3: 26
4: 336
Right 1099844636 12:88014195-88014217 AGATCAGGAGGTCTGATGCATGG 0: 1
1: 0
2: 4
3: 14
4: 162
1099844631_1099844636 -3 Left 1099844631 12:88014175-88014197 CCCCTCAGAAGGCAGAAGACAGA 0: 1
1: 0
2: 4
3: 65
4: 446
Right 1099844636 12:88014195-88014217 AGATCAGGAGGTCTGATGCATGG 0: 1
1: 0
2: 4
3: 14
4: 162
1099844632_1099844636 -4 Left 1099844632 12:88014176-88014198 CCCTCAGAAGGCAGAAGACAGAT 0: 1
1: 0
2: 0
3: 30
4: 334
Right 1099844636 12:88014195-88014217 AGATCAGGAGGTCTGATGCATGG 0: 1
1: 0
2: 4
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099844636 Original CRISPR AGATCAGGAGGTCTGATGCA TGG Intronic
902203722 1:14852336-14852358 AGATCAGCTGGGCTGAAGCATGG - Intronic
902647051 1:17806884-17806906 AGTTCTGGAGGTCAGAAGCACGG + Intronic
902890390 1:19439070-19439092 CGTTCAGGAGGTATGAAGCATGG + Intronic
905304400 1:37007520-37007542 GGCTCAGGAGAACTGATGCATGG + Intronic
905916579 1:41688777-41688799 AGCTCAGGATGTCTGGAGCATGG - Intronic
906196345 1:43932857-43932879 AGAGGATGAGGTCTGATGCAGGG - Intergenic
906317047 1:44793188-44793210 AGCTCAGGCTGTCTGATCCATGG - Intergenic
907783188 1:57586047-57586069 ACATCAGGAGGGTTGATCCAAGG + Intronic
909085678 1:71167555-71167577 AGATCAGGTGGTATGTTACAGGG + Intergenic
911310724 1:96289207-96289229 GGAGCATGAGATCTGATGCATGG + Intergenic
911745647 1:101439135-101439157 ACATCAAGAGGTTTGAAGCATGG + Intergenic
915764261 1:158347743-158347765 AGTTCTGGAGGTCTAATGCACGG + Intergenic
916214308 1:162382767-162382789 AGAACAGGAGGGCTGCTACAGGG - Intronic
918515429 1:185358247-185358269 AGATCAGGAGGGGTCATCCAAGG - Intergenic
919957476 1:202433341-202433363 AGAACAAGAGATCTGACGCAAGG - Intronic
920593091 1:207241473-207241495 GCATCAGGGGCTCTGATGCAAGG - Intergenic
921423304 1:214973902-214973924 ACAACAGGAGTGCTGATGCAGGG - Intergenic
923627195 1:235623657-235623679 AGGTCAGGACAGCTGATGCAAGG - Intronic
923826951 1:237510950-237510972 AGATCAGGAGGTAACATGCAGGG + Intronic
1063135883 10:3215692-3215714 GGAGCAGGGTGTCTGATGCAAGG + Intergenic
1064683556 10:17835839-17835861 AGATCAGTAGGTGTGACACAGGG + Intronic
1067658272 10:48213795-48213817 AGATCAGGAGTTTGGAGGCAGGG + Intronic
1068533152 10:58211143-58211165 AGATCAGTAGGATTGATGGATGG + Intronic
1068630304 10:59291002-59291024 GGTTCAGTAGGTCTGAGGCAGGG + Intronic
1071712638 10:88064647-88064669 AGATCAGCATCTCTCATGCAAGG + Intergenic
1072547890 10:96454552-96454574 AGAACTGGAGGTTTGATGCCAGG - Intronic
1072790805 10:98316343-98316365 AGGTCACGAGATCTGAGGCATGG + Intergenic
1073110894 10:101062501-101062523 AGGTCAGGAGGTCAGAAACAGGG - Intronic
1074426254 10:113354029-113354051 AAGTCAGGGGGTCTGATGGAAGG + Intergenic
1074790503 10:116881713-116881735 AGACCGGGAGGTCTGAAGTACGG + Exonic
1076436088 10:130442832-130442854 AGATCAGAGGGGCTGATTCATGG + Intergenic
1076485724 10:130815517-130815539 AGATCTGGAGGCCTGATGCAAGG + Intergenic
1080306213 11:30839493-30839515 AGCTCAGCTGGTCTTATGCAGGG + Intronic
1088506353 11:110531485-110531507 AGATCAAGGGGTGTGGTGCAGGG + Intergenic
1089436440 11:118472817-118472839 AGACGAGGAGGTCTGCTGCTGGG - Exonic
1096000398 12:48125075-48125097 AGCTCAGGATGTCTGATTCCTGG - Intronic
1099789985 12:87321671-87321693 ACACCAGAACGTCTGATGCAGGG + Intergenic
1099844636 12:88014195-88014217 AGATCAGGAGGTCTGATGCATGG + Intronic
1100391993 12:94151328-94151350 AAACCAGGAGGTCTTTTGCAAGG + Intronic
1100435678 12:94569370-94569392 AGATAAGGAGGCCAGGTGCAAGG - Exonic
1101044367 12:100789317-100789339 AGACCAGCAGGACTGAAGCAAGG + Intronic
1101471268 12:104999297-104999319 GGATCAGGTGGTCTGGTGCACGG + Intronic
1103005956 12:117420484-117420506 AGACCAGGAGGTCTGACCCTGGG + Intronic
1103617682 12:122165104-122165126 AGACCCTGAGGCCTGATGCAGGG - Intergenic
1103654540 12:122459770-122459792 AGATCATGATGTCTGAGGCCGGG + Intergenic
1104503653 12:129310240-129310262 AGGTCAGGAGGTAGGATGCCAGG + Intronic
1108860505 13:54852823-54852845 AGTCCAGGAGGTCTGAAACATGG - Intergenic
1110838407 13:80111765-80111787 TGATCAGGAGTTCTTAGGCAAGG + Intergenic
1112403239 13:99094559-99094581 AGATCAGAAGGAATAATGCATGG + Intergenic
1117255396 14:53971961-53971983 AAATTAAGAGGTCTGCTGCAGGG - Intergenic
1118823629 14:69361428-69361450 AAATCATGAAGTCTGATCCAGGG + Intergenic
1121097682 14:91229202-91229224 ACATCAGGGGCTCTGATGCAAGG + Intergenic
1122444492 14:101759581-101759603 GGATCAGGAGATATGATACAAGG + Intergenic
1122866920 14:104610372-104610394 AGGTCAGGAGGGCTCATGAATGG + Intergenic
1127298098 15:57627478-57627500 AGAGGAAGAGGGCTGATGCACGG + Intronic
1128378186 15:67092143-67092165 AGATCAGGAGGCCTCCAGCAGGG - Intronic
1129945866 15:79538965-79538987 AGATCAGGAGGACAGAACCAGGG + Intergenic
1134282305 16:12828106-12828128 AGAGCAGGAGGACTGGTTCATGG + Intergenic
1134641377 16:15831950-15831972 AGATCAGAAGGGCTAATGCTTGG + Intronic
1135771359 16:25220720-25220742 CAATCAGGAGGTCTTATTCAGGG + Intronic
1137492892 16:48947950-48947972 AGATCAGGTGGCCTTATTCAGGG - Intergenic
1139483582 16:67244316-67244338 AGATTAGGAGATGAGATGCAAGG + Intronic
1140657725 16:77157496-77157518 CTCCCAGGAGGTCTGATGCAAGG + Intergenic
1141935175 16:87233730-87233752 AGTTCAGGAAGGCTGAGGCAAGG + Intronic
1143971474 17:10799135-10799157 AGATGAGGAGGTCCCATGCTCGG - Intergenic
1144071149 17:11672275-11672297 AGATCCTGAGGTCTGGTGCAAGG - Intronic
1146506845 17:33413179-33413201 AAATCAGGAGCTCTGACTCAGGG + Intronic
1147950269 17:44103598-44103620 AGATCAAGAGGTGCGAGGCAGGG + Intronic
1148784347 17:50138282-50138304 AGACCAGGTGGTCTGATCGATGG + Intronic
1151627763 17:75288195-75288217 AGGTCAGTAGGTCTGAGTCAGGG - Intronic
1153521332 18:5957246-5957268 AGATCTGGGGCTCTGATGTATGG + Intronic
1155547744 18:26932314-26932336 AGATAAGGAGATTTGTTGCAAGG - Intronic
1157134762 18:45042929-45042951 AGCCAAGGAGGTCTGATTCAAGG + Intronic
1157348200 18:46859700-46859722 AGATAAGCAGGTTTGATGGAAGG + Intronic
1163655392 19:18542772-18542794 GGTTCAGGAGGTCTGGGGCAAGG - Intronic
1166360760 19:42252117-42252139 AGATCACAAGGTCTCCTGCAAGG + Intronic
926285828 2:11487305-11487327 AGATCAAGAGGACTGAGGCAAGG - Intergenic
927871458 2:26627008-26627030 AGATCAGGAGGGCTGAGTCTGGG - Intronic
933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG + Intergenic
934126384 2:88896868-88896890 AGAACAGGATGCCTGATGCAGGG + Intergenic
936246581 2:110833689-110833711 AGTGCAGGAGATCTGTTGCAGGG - Intronic
937775837 2:125774904-125774926 AGAGCAGGTGGTATGATGGAAGG - Intergenic
937811121 2:126200583-126200605 AGAATAGGAAGACTGATGCAGGG - Intergenic
938650629 2:133379369-133379391 ACATCTGGAGTTCAGATGCAGGG - Intronic
948773926 2:240270257-240270279 AGCTCAGGTGGGCTGGTGCAGGG - Intergenic
948858218 2:240740482-240740504 AGATCAGGTGGTCTGATCCATGG + Intronic
948965283 2:241374820-241374842 AGAGAAGGAGGTCTGAAGCTGGG + Intronic
1170916493 20:20631528-20631550 AGAAAAGGTGGTGTGATGCAGGG + Intronic
1172704589 20:36873435-36873457 AGGTCAGGAGGTTGGATGCCTGG + Intergenic
1173015072 20:39217797-39217819 AAATAAGGAGGACTGATACATGG - Intergenic
1174157047 20:48522330-48522352 AGAGCAGGGGGTCTGGTGCAGGG - Intergenic
1174270858 20:49367335-49367357 AGAGCAGGAGGTGTGTGGCAAGG - Exonic
1174304904 20:49608250-49608272 AGACCATGGGGTCAGATGCAGGG - Intergenic
1175999148 20:62824382-62824404 AGAGCAGGACGTCCGACGCAGGG - Intronic
1177384856 21:20395593-20395615 AGTTCAAGAGTTCTGAAGCAAGG + Intergenic
1182558370 22:31141040-31141062 AGACCAGGAGGGTTGCTGCAAGG - Intergenic
1183797373 22:40130868-40130890 AGATCAGGAGCCCTTATGGATGG + Intronic
949569561 3:5279245-5279267 AGATCTGCAGGTCTGATTCTGGG - Intergenic
950225543 3:11230610-11230632 GGCTCAGGAGGTCTGAGGTAGGG - Intronic
950708472 3:14798445-14798467 AGATCAGGAGAGCCGACGCAGGG + Intergenic
951835034 3:26973649-26973671 AGAGAAGGAGATCTGATGCTGGG - Intergenic
952130782 3:30359847-30359869 AAATCAGGAGGTCTGTTGAAGGG - Intergenic
952306814 3:32154207-32154229 AGATCAGGAGACCTAGTGCAGGG - Intronic
955101349 3:55853106-55853128 AGATCAGGAGTTCTCAACCAGGG - Intronic
955934342 3:64088489-64088511 AGATCATCAGGGCTGATGGATGG - Intergenic
957356539 3:79095001-79095023 ATCTCAGGATGTCTGATTCATGG - Intronic
963457589 3:145564838-145564860 AGGTCAGTAGGCCTGAGGCATGG + Intergenic
967947077 3:194812462-194812484 AGATCATGAGGAAAGATGCAGGG + Intergenic
969158455 4:5233772-5233794 AGATCAGGAGGTGAGGTCCATGG + Intronic
970345577 4:15149427-15149449 AGAGCAGGCAGTCTGATGCGGGG - Intergenic
971028210 4:22609041-22609063 AGATAAGGAGATTTGTTGCAAGG - Intergenic
972049972 4:34718421-34718443 AGATCAAGAGGCATCATGCATGG + Intergenic
975328315 4:73085350-73085372 ATTTCAGGAGGTCAGATGTACGG - Exonic
975974671 4:80081379-80081401 AAATCAGGAGGACTTCTGCATGG + Intronic
977495544 4:97770826-97770848 AGATCAGGATGTAAGAGGCAGGG + Intronic
979420486 4:120499123-120499145 ACATCAGGAGATATGATGCTGGG - Intergenic
980818109 4:137975404-137975426 AGCTGAGGAGGTCTGATCAAAGG - Intergenic
982046795 4:151455662-151455684 AGATCAGGACCACTGATGGAAGG - Intronic
986741267 5:10707447-10707469 AGAGCTGGTGGTGTGATGCACGG + Intronic
990011559 5:51005208-51005230 AGATCAGTAGGTCTCAAACATGG + Intergenic
990789482 5:59460839-59460861 AGAGCAAGAGGCATGATGCAGGG + Intronic
990895363 5:60694283-60694305 AGATCTGCAGGTATGACGCAGGG - Intronic
991389077 5:66123078-66123100 AGAGCAGGAGGTTTGATATAGGG + Intergenic
991452571 5:66768593-66768615 AGAACTGGAGGACTGATTCATGG + Intronic
994758513 5:103824371-103824393 AGATCAGGAAGTTTCATGAAAGG + Intergenic
995348347 5:111147012-111147034 AAAACATGAGGTCTGATTCAAGG + Intergenic
996154095 5:120076947-120076969 AGATCTGAAGGGCAGATGCAAGG - Intergenic
997073544 5:130645235-130645257 AGAGCAGGTGGAATGATGCAAGG - Intergenic
997786465 5:136718236-136718258 AGCTCTGCAGCTCTGATGCAGGG - Intergenic
1000907827 5:166984774-166984796 AGATCAGAAAGTCTGTTGCAAGG - Intergenic
1001118405 5:168958721-168958743 AGATCAGAAGGTCACCTGCAAGG + Intronic
1003021310 6:2512000-2512022 ATATAAGGCGGTCTGATGAAGGG - Intergenic
1004545675 6:16596288-16596310 AGAAAAGGAGGTCTGAGGCTGGG - Intronic
1005753938 6:28909041-28909063 AAATCTGGAGGTGTGATCCAAGG + Exonic
1007655072 6:43446782-43446804 AGCACAGGAGGCCAGATGCAGGG - Intronic
1008075360 6:47139848-47139870 AGATCTGGAGGTCAGAGGAAGGG - Intergenic
1008124818 6:47656298-47656320 AGCACAGGATGTGTGATGCATGG - Intergenic
1008426784 6:51367558-51367580 AGACCAGGAGGCCTGATGTCAGG - Intergenic
1008665420 6:53711074-53711096 AGATAAGGAAGGCTGAAGCATGG + Intergenic
1010315496 6:74444471-74444493 AGATCAAGAAGAGTGATGCATGG + Intergenic
1010654308 6:78494165-78494187 AGATCAGTAGGGCTGAAGAATGG - Intergenic
1015600808 6:134908783-134908805 AGATAAGCAGATCTGAAGCAAGG - Intergenic
1018897181 6:168027720-168027742 GGAGCACGAGGTCAGATGCATGG + Intronic
1018978492 6:168583382-168583404 AGACCAGGAGGGGTGAGGCAGGG - Intronic
1019095969 6:169579417-169579439 AAATTAGGGGGTCTGAGGCAGGG + Intronic
1021262908 7:18481003-18481025 AGAACTGGAGCTCTGCTGCAGGG - Intronic
1022490917 7:30817016-30817038 AGAACATGAGGTCTCATGAAGGG - Intronic
1022537753 7:31108403-31108425 GGATCATGAGGTCAGGTGCAGGG - Exonic
1024904511 7:54361406-54361428 TGATCAGTAGGTCTGAGGCAGGG + Intergenic
1026072824 7:67137787-67137809 TGGACAGGATGTCTGATGCAGGG - Intronic
1026388350 7:69874543-69874565 AGATGAGGAGGTCTGAATTAAGG + Intronic
1032644897 7:133812817-133812839 AGATCAAGAGATCTAATACACGG - Intronic
1032663927 7:134016114-134016136 AGAGGAGTAGGTCTGATGGAGGG + Intronic
1037687710 8:21157843-21157865 AGATCATGAGGGCTCATGAATGG + Intergenic
1041539695 8:58969504-58969526 AGATCATGAGGTTTTATGAAGGG - Intronic
1042141713 8:65685826-65685848 AGATCAGGAGTTCTCAGGGAAGG + Intronic
1045649471 8:104328720-104328742 AGATCAGGCTGTTGGATGCATGG + Intergenic
1046330357 8:112706613-112706635 AGAACTGGAGTTCAGATGCAGGG + Intronic
1047989842 8:130274481-130274503 AGATCGAGTGGTCTGGTGCAAGG - Intronic
1048141157 8:131795976-131795998 AGATAAGAAGGTCAGATGGATGG + Intergenic
1048632056 8:136254559-136254581 AGATAAGGAAGTCTAATCCAAGG - Intergenic
1057861012 9:98640849-98640871 TGATCAGTAGGTCTGATGCATGG + Intronic
1058248316 9:102659054-102659076 AAATCAGGAGAGATGATGCAAGG - Intergenic
1059751416 9:117250982-117251004 AGTTCAGAAGGGCTGAAGCAGGG + Intronic
1060690140 9:125650463-125650485 GGAACAGAAGGTCTGAGGCAAGG - Intronic
1185942208 X:4334253-4334275 AGTTCTGGAGGTCTAATGCATGG + Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1186826995 X:13350339-13350361 AGAACAAGAAGTCTGCTGCAAGG + Intergenic
1187045518 X:15644733-15644755 AGATCAGTAGTTCTCATCCAGGG - Intronic
1187221915 X:17336139-17336161 GGTTCAGTAGGTCTGAGGCAGGG - Intergenic
1187298710 X:18027438-18027460 AGTTCAGGAGGTCTGATGCTGGG + Intergenic
1188612662 X:32118983-32119005 ACATCAGGAGGTGAGCTGCAGGG - Intronic
1189699336 X:43700674-43700696 AAATCTGGAGGTCTAAGGCATGG + Intronic
1190260222 X:48792691-48792713 AGGGCAGGAGTTCTCATGCAGGG - Intronic
1191161142 X:57330893-57330915 AGGTCAGGAATTGTGATGCAGGG + Intronic
1192046995 X:67686347-67686369 AGAGCAGGCGGTGTGAAGCAGGG + Intronic
1193626724 X:83831164-83831186 ACATCAGGAGGTCTTATGCTTGG - Intergenic
1193823506 X:86195041-86195063 GGAGCAGGAGGACTGGTGCATGG - Intronic
1195410630 X:104565544-104565566 AGAGCAGGTGATCAGATGCATGG + Intergenic
1196080796 X:111628306-111628328 AGATCATGAGGGCTCATGAATGG + Intergenic
1197621986 X:128761061-128761083 AAATCAGTAGGTCTGGGGCAGGG + Intergenic