ID: 1099854948

View in Genome Browser
Species Human (GRCh38)
Location 12:88152240-88152262
Sequence TACTACCTGTAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099854948 Original CRISPR TACTACCTGTAGAAGGTGAA GGG Intronic
902409384 1:16204185-16204207 GACTACCTGGATAAGGTGAATGG - Intronic
904463211 1:30692667-30692689 TTCTACCTGGAGGAGGAGAATGG + Intergenic
904824304 1:33264675-33264697 TCCTGCCTCTATAAGGTGAAGGG - Intronic
905540123 1:38753983-38754005 TACTTGCAGTGGAAGGTGAAGGG - Intergenic
907904305 1:58770277-58770299 TCCTTCATGTAGAAGGCGAATGG - Intergenic
910134811 1:83955399-83955421 TAGGACCTTTAGAAGGTGATTGG + Intronic
916164122 1:161949627-161949649 TACTCACAGCAGAAGGTGAAGGG + Intronic
916439507 1:164809194-164809216 AACTTCCTGTTGAAGGTAAAAGG + Intronic
916493487 1:165324186-165324208 GACCACCTGCAGAAGGTGAGGGG + Intronic
918627042 1:186668105-186668127 TACTGCCTATATAAGGTGTAAGG + Intergenic
922351881 1:224740944-224740966 AACTGGATGTAGAAGGTGAATGG + Intergenic
922899033 1:229122183-229122205 CACTCTCAGTAGAAGGTGAAGGG - Intergenic
923044985 1:230349167-230349189 CACTAACTGTAGAGGGAGAAGGG + Intronic
1064007786 10:11712255-11712277 TACTCAGGGTAGAAGGTGAAGGG - Intergenic
1065084729 10:22163406-22163428 TACTAATGGTGGAAGGTGAAGGG + Intergenic
1065772207 10:29088051-29088073 CAGTAACAGTAGAAGGTGAAGGG - Intergenic
1072306952 10:94116810-94116832 CACTTCTTTTAGAAGGTGAAGGG - Intronic
1074355789 10:112781930-112781952 TAATACCTGTAGCAGATAAATGG - Intronic
1076021819 10:127080062-127080084 TCCTAGCTGTAAGAGGTGAATGG - Intronic
1084663539 11:70561861-70561883 TTCTACCTTTAGAAGCTAAAAGG - Intronic
1084976984 11:72806583-72806605 CACTCACTGTGGAAGGTGAAGGG + Intergenic
1086538037 11:87872847-87872869 TACGTCCTTTAGAGGGTGAATGG - Intergenic
1086599506 11:88615518-88615540 AGCTACCTGAAGAAGGTGAAAGG - Intronic
1086766268 11:90699222-90699244 TATTACATGTAGAAGCTGCAGGG - Intergenic
1087649290 11:100846105-100846127 TTCTACTTCTAAAAGGTGAATGG - Intronic
1088178243 11:107078871-107078893 TACTCATGGTAGAAGGTGAAGGG + Intergenic
1088859873 11:113789722-113789744 CACCACCTGTAGAAGCTGGAGGG + Intergenic
1088978439 11:114837478-114837500 TACAACTTGTAGAAAGGGAAAGG + Intergenic
1090860317 11:130647279-130647301 TATTCCCAGTGGAAGGTGAAGGG + Intergenic
1090982552 11:131736210-131736232 TACTAGCTGTAGAAGGTTCGGGG - Intronic
1093050230 12:14495823-14495845 TACCACATGTAAAAGGTAAATGG - Intronic
1094017645 12:25881848-25881870 TACTACCAGTGGAAAGTGTAAGG + Intergenic
1099329779 12:81269290-81269312 TACTACCCATAGAAAGGGAAAGG + Intronic
1099491915 12:83299249-83299271 TTCTACCTGAAGAAAGAGAAGGG + Intergenic
1099854948 12:88152240-88152262 TACTACCTGTAGAAGGTGAAGGG + Intronic
1100168892 12:91949870-91949892 TAATATCTGTATAATGTGAAAGG - Intergenic
1103133390 12:118487679-118487701 TACTTCCTGGAGAGGGAGAATGG + Intergenic
1109371666 13:61428726-61428748 CACTCCCGGTGGAAGGTGAAGGG - Intergenic
1109465491 13:62726710-62726732 TAATTTCTGTAGAAGGTGTAAGG + Intergenic
1109765595 13:66891922-66891944 TTCTAGCTACAGAAGGTGAAGGG - Intronic
1110269903 13:73577951-73577973 AAATACTTGTAGAATGTGAAGGG - Intergenic
1110849518 13:80229160-80229182 TACTCATGGTAGAAGGTGAAAGG + Intergenic
1111017831 13:82404222-82404244 TAATTCCTGTATAAGGTGTAAGG - Intergenic
1113795556 13:113055786-113055808 TGCTCCCTGCAGAAGGTGAATGG + Intronic
1113898669 13:113783638-113783660 TACTTCCTGGAGAGGGAGAATGG + Intronic
1114454275 14:22845234-22845256 TAGTACCTGGGGAAGGGGAAAGG - Exonic
1115926442 14:38441115-38441137 TACTACATGGAGAGGGGGAAAGG + Intergenic
1124511087 15:30326508-30326530 CACCACCAGTGGAAGGTGAAGGG - Intergenic
1124731827 15:32204257-32204279 CACCACCAGTGGAAGGTGAAGGG + Intergenic
1128750588 15:70146221-70146243 TACTAATGGTGGAAGGTGAAAGG + Intergenic
1131530020 15:93182984-93183006 TAATTCCTGTAGAAAGGGAAAGG + Intergenic
1133732017 16:8586153-8586175 TACTACCTCTAGAAGGAGGCTGG + Intronic
1134809614 16:17156390-17156412 TGCTACCTGGAGAAGAAGAAGGG + Intronic
1135673794 16:24396998-24397020 TACTCCTAGTGGAAGGTGAAAGG + Intergenic
1137455927 16:48617879-48617901 TCCTAGCTGTAGAGGGTGATGGG - Intronic
1137646676 16:50080965-50080987 TACTCCCTGTAGAAGGTCCTTGG - Intronic
1139207088 16:65039535-65039557 TAATTTCTGTAGAAGGTGTAAGG - Intronic
1140326525 16:74009197-74009219 TACTATCTGTGGATGGAGAAAGG + Intergenic
1140651058 16:77089082-77089104 TACTATATATAGACGGTGAAAGG + Intergenic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1145191109 17:20842648-20842670 TCCTGCCTGTAGCAGGTGACAGG + Intronic
1145800511 17:27680799-27680821 TACTACCTGATGAAGGTTAGTGG + Intergenic
1146691275 17:34877891-34877913 TCCTGCCTGTAAAATGTGAAGGG + Intergenic
1150577928 17:66446374-66446396 TCCATCCTGGAGAAGGTGAATGG - Intronic
1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG + Exonic
1151687871 17:75659983-75660005 TACTCCCTGTGGAAGGTCAAAGG - Intronic
1153120314 18:1716697-1716719 GAGTACCTTTAGAAAGTGAATGG + Intergenic
1153353522 18:4108821-4108843 TATTTCCAGTAGAAGGAGAAAGG + Intronic
1155167341 18:23241942-23241964 TACCTACTGTAGAAGGTCAAGGG + Intronic
1159364303 18:67446073-67446095 TACTTTTTGTAGAAGGTGTAAGG - Intergenic
1162352446 19:10158782-10158804 TGCCAGCTGTGGAAGGTGAATGG - Intronic
1168105183 19:54162094-54162116 TTCTACCTGAAGAAGGTAAGGGG - Exonic
926276525 2:11407384-11407406 GGCTAACTGCAGAAGGTGAATGG + Intergenic
927300348 2:21505123-21505145 TACTCGCTGTTGAAAGTGAATGG - Intergenic
928363096 2:30681196-30681218 TACTCCTGGCAGAAGGTGAAGGG + Intergenic
928382857 2:30835291-30835313 TAGTAACTATAAAAGGTGAAGGG - Intergenic
930710446 2:54545947-54545969 TATTTCCTGTAGAAGGACAAAGG - Intronic
930984865 2:57573151-57573173 TACTCATTGTAGAAGGTGAAGGG - Intergenic
935921230 2:108017769-108017791 AACTACCTGGACAAAGTGAAGGG - Intergenic
936901285 2:117484712-117484734 TTCTACTTGTAGAAAATGAAGGG - Intergenic
947005665 2:225508600-225508622 TAGCACCTGTAGAAGGAGAGGGG + Intronic
947998436 2:234547899-234547921 TACCTCCTGTGGAAGGTGGAAGG - Intergenic
1169362462 20:4962565-4962587 AACTACCTGCAAAAGGTAAAAGG + Intronic
1173560592 20:44002711-44002733 TACTCCTGGGAGAAGGTGAAGGG + Intronic
1174713901 20:52736202-52736224 TACTACCTGAAGGAGTTGTAGGG + Intergenic
1174932872 20:54834445-54834467 TACAAGCTGGAGAAGGGGAAAGG + Intergenic
1177676722 21:24309902-24309924 TACTCACAGCAGAAGGTGAAGGG + Intergenic
1178922151 21:36745771-36745793 TGCCACCAGGAGAAGGTGAAAGG - Intronic
1179411905 21:41168537-41168559 TACTACCTGGAGATGCTGATCGG + Exonic
1181334116 22:22116339-22116361 TCCTGCCTGTAGCAGGTGACAGG - Intergenic
1181557102 22:23677458-23677480 TACTACCTGTGGAGGGTGCCTGG - Intergenic
1182540301 22:31036522-31036544 TGCTGCCTGAAGAAAGTGAAGGG + Intergenic
1182726003 22:32446122-32446144 TCCTACCTGTTGTAGGTGCAAGG - Intronic
1182865160 22:33597977-33597999 TACTTCCTGTAGGGGATGAAAGG - Intronic
1185042635 22:48513181-48513203 GACTTCCTGTAGACGGTGTAGGG - Intronic
950403479 3:12788940-12788962 TAATAAATGTAGAAGGTGACTGG + Intergenic
950853901 3:16087865-16087887 GACTACCTTGAGAAGGTGAGGGG + Intergenic
951044325 3:18021549-18021571 TCCTACCTGTAGCATGTGAGAGG + Intronic
951950633 3:28196709-28196731 TACAATCTGTAAAAGGGGAATGG + Intergenic
953522269 3:43655160-43655182 TATTACCTGTAAAGAGTGAAAGG - Intronic
954388269 3:50255663-50255685 TCCCACCTGTAGAATGGGAATGG - Intronic
954531526 3:51324891-51324913 TAATATCTGTATAAGGTGTAAGG - Intronic
960021956 3:112965003-112965025 TAATAATGGTAGAAGGTGAAAGG - Intronic
963280390 3:143378883-143378905 CAATACCTTTAGAATGTGAATGG - Intronic
965022698 3:163254001-163254023 TGCTAGCTGTAGAACATGAATGG + Intergenic
965055776 3:163713547-163713569 TAATCCCTGTAGAAGGTAAATGG - Intergenic
970815059 4:20145357-20145379 TACTTTTTGTATAAGGTGAAAGG - Intergenic
970939385 4:21613676-21613698 TACTACCTGGACAACATGAAGGG - Intronic
975717192 4:77216502-77216524 TACTTCCTGAAGGAGGTGAGAGG - Intronic
983978318 4:173964107-173964129 TAATACTTGTATAAGGTGTAAGG + Intergenic
985583716 5:715009-715031 CACTAACAGCAGAAGGTGAAGGG - Intronic
985597224 5:799306-799328 CACTAACAGCAGAAGGTGAAGGG - Intronic
987560609 5:19515013-19515035 TAATATCTGTATAAGGTGTAAGG + Intronic
987706942 5:21470071-21470093 TACTACCTAGAAATGGTGAATGG - Intergenic
990044335 5:51410587-51410609 AAATCCCTGTAGAGGGTGAAAGG - Intergenic
990119368 5:52430848-52430870 TAATACATGTAGAATCTGAATGG - Intergenic
992383982 5:76266060-76266082 CTCTACCTGCAGAAGGTGAGAGG + Intronic
993410811 5:87571141-87571163 GACTTCCTCTAGAAGATGAAAGG + Intergenic
994274653 5:97821780-97821802 TTCTACCTGTGGAAAGGGAAGGG - Intergenic
994713045 5:103289022-103289044 TATTACTTGTCAAAGGTGAATGG - Intergenic
997246753 5:132356234-132356256 TACTCACAGTGGAAGGTGAAGGG - Intergenic
997399694 5:133592787-133592809 CACTCCTGGTAGAAGGTGAAAGG - Intronic
998200041 5:140112397-140112419 AGCTGCCTGTAGAAGGTGATGGG + Intronic
998817498 5:146028913-146028935 TCCTAGCTGGAGAAGCTGAAAGG + Intronic
999444400 5:151627910-151627932 TACAAGCTGGAGAAGGTGGAAGG + Intergenic
1002547915 5:179963718-179963740 TACTAACTGGAGAAGGTTAGTGG + Intronic
1004030200 6:11860732-11860754 TTCTACCTGTAGAGGGGGACAGG - Intergenic
1006448816 6:34094271-34094293 TACAAAGGGTAGAAGGTGAAAGG - Intronic
1008627471 6:53331932-53331954 TACTCACTGTGAAAGGTGAAGGG + Intronic
1014641181 6:123912673-123912695 CACTAACAGCAGAAGGTGAAGGG - Intronic
1019113071 6:169733452-169733474 TACTTCTTGTATAAGGTGTAAGG + Intergenic
1020464448 7:8461271-8461293 TACAACCTGGAGAATGAGAAAGG - Intronic
1022178043 7:27891095-27891117 TACTACTTTTAAAAGGAGAAGGG + Intronic
1024115545 7:46189615-46189637 TCCTATCAGAAGAAGGTGAAGGG + Intergenic
1024597932 7:50955661-50955683 TACTCACGGCAGAAGGTGAAGGG + Intergenic
1027710928 7:81600505-81600527 AAATCCCTGCAGAAGGTGAAGGG - Intergenic
1028697446 7:93731411-93731433 TACCATCTCTAGAAGGAGAATGG + Intronic
1029591328 7:101509061-101509083 TACTAGTGGCAGAAGGTGAAGGG + Intronic
1032348739 7:131140599-131140621 TACTCACGGCAGAAGGTGAAGGG - Intronic
1032752137 7:134852153-134852175 TAATTGCTGTAGAAGCTGAAAGG + Intronic
1033091522 7:138390440-138390462 TAATCCCAGGAGAAGGTGAAAGG - Intergenic
1033315968 7:140297814-140297836 TACTGCCTAGAGAAGATGAAAGG - Intronic
1036542052 8:9725014-9725036 TATTACCTGTAGATATTGAAAGG + Intronic
1036962502 8:13260446-13260468 GGCCACCTGTAGAAGATGAATGG + Intronic
1037093226 8:14948588-14948610 AACTACCTGGAGTAGGTTAAGGG - Intronic
1042019776 8:64359410-64359432 TACTCCCTGTAGGATGTCAAGGG + Intergenic
1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG + Intronic
1042607227 8:70557656-70557678 TACTCCTGGTGGAAGGTGAAGGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045258215 8:100547411-100547433 GAATCCCTGTGGAAGGTGAAAGG - Intronic
1047519150 8:125581099-125581121 TACTCATGGTAGAAGGTGAAGGG + Intergenic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1055627855 9:78193003-78193025 TACTGCCTCTGGAAGGTGGAGGG + Intergenic
1055807662 9:80114923-80114945 AACTGCCTGTAGAATGTGGATGG - Intergenic
1058242861 9:102588018-102588040 TAATAACAGTAAAAGGTGAAAGG + Intergenic
1060009397 9:120030290-120030312 TGCAACCTCTAGAAGCTGAAAGG - Intergenic
1061759461 9:132840118-132840140 TACTACCTTTAAGAGGTGACTGG - Intronic
1186026986 X:5324045-5324067 TCTTACCTGAAGAAGTTGAATGG - Intergenic
1189507709 X:41628639-41628661 TACTTACTGTAGAAAGGGAAGGG + Intronic
1190605990 X:52143408-52143430 TACTGAAGGTAGAAGGTGAAGGG + Intergenic
1190916008 X:54811639-54811661 TATTCCTTGGAGAAGGTGAAGGG + Exonic
1190927905 X:54925054-54925076 TACACTCTGGAGAAGGTGAAGGG + Exonic
1193632739 X:83909992-83910014 TACTTCTTGTATAAGGTGTAAGG - Intergenic
1193696521 X:84713339-84713361 TATTTCCTTTAGAAGGTAAATGG + Intergenic
1194914766 X:99691987-99692009 TACTACTGGTAGAGGGTGGAAGG + Intergenic
1195422813 X:104694566-104694588 AAAGACCTTTAGAAGGTGAAGGG + Intronic
1196184976 X:112736367-112736389 AACTTACTGTAGTAGGTGAAAGG - Intergenic
1196789428 X:119450787-119450809 TACTACCTGTCCACTGTGAAGGG - Intronic
1197338462 X:125236686-125236708 TACAACTTTTAGAAGGTAAATGG + Intergenic
1198314285 X:135451072-135451094 TACTCATGGTAGAAGGTGAAGGG + Intergenic
1198948558 X:142042425-142042447 ATCTAACAGTAGAAGGTGAAGGG + Intergenic
1202030955 Y:20573506-20573528 AAATCACTGTAGAAGGTGAAGGG + Intergenic