ID: 1099859640

View in Genome Browser
Species Human (GRCh38)
Location 12:88210498-88210520
Sequence CTGTATGTCAGATCTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099859640_1099859644 -5 Left 1099859640 12:88210498-88210520 CCACCCTTAGATCTGACATACAG No data
Right 1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG No data
1099859640_1099859645 12 Left 1099859640 12:88210498-88210520 CCACCCTTAGATCTGACATACAG No data
Right 1099859645 12:88210533-88210555 ACAGGGCTCTTCAAAGATGCAGG 0: 118
1: 138
2: 123
3: 118
4: 251
1099859640_1099859643 -6 Left 1099859640 12:88210498-88210520 CCACCCTTAGATCTGACATACAG No data
Right 1099859643 12:88210515-88210537 ATACAGAGAAGAGTAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099859640 Original CRISPR CTGTATGTCAGATCTAAGGG TGG (reversed) Intergenic
No off target data available for this crispr