ID: 1099859641

View in Genome Browser
Species Human (GRCh38)
Location 12:88210501-88210523
Sequence TCTCTGTATGTCAGATCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 45, 1: 35, 2: 21, 3: 35, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099859641_1099859644 -8 Left 1099859641 12:88210501-88210523 CCCTTAGATCTGACATACAGAGA 0: 45
1: 35
2: 21
3: 35
4: 180
Right 1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG No data
1099859641_1099859643 -9 Left 1099859641 12:88210501-88210523 CCCTTAGATCTGACATACAGAGA 0: 45
1: 35
2: 21
3: 35
4: 180
Right 1099859643 12:88210515-88210537 ATACAGAGAAGAGTAATTACAGG No data
1099859641_1099859645 9 Left 1099859641 12:88210501-88210523 CCCTTAGATCTGACATACAGAGA 0: 45
1: 35
2: 21
3: 35
4: 180
Right 1099859645 12:88210533-88210555 ACAGGGCTCTTCAAAGATGCAGG 0: 118
1: 138
2: 123
3: 118
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099859641 Original CRISPR TCTCTGTATGTCAGATCTAA GGG (reversed) Intergenic
900555698 1:3279332-3279354 TCTCTGCGTTTCAGATCTGAGGG - Intronic
901904315 1:12394538-12394560 TCTCTGTATGTCAGATCTAACGG - Intronic
905353820 1:37366921-37366943 TTTTTGTATGTCAGAACTAATGG + Intergenic
906593452 1:47050161-47050183 TCTCTGAATGTTAGATCTCAGGG + Exonic
909423837 1:75498241-75498263 TCCCAGTAGGTCAGATATAATGG + Intronic
910451346 1:87349135-87349157 ATTCTGAATGTCAGATCTACGGG - Intergenic
910525360 1:88172056-88172078 CCTCTAAATGTCAGATATAAAGG + Intergenic
910948178 1:92616299-92616321 TCTTAGTATGTCAGATCTAATGG + Intronic
912944064 1:114070037-114070059 TCTCTGTATGTCAGATTGAATGG - Intergenic
914321375 1:146565262-146565284 TCTCTGTCTGTAAAATCTAAGGG - Intergenic
914323933 1:146592562-146592584 TCTGGGGATGTGAGATCTAAAGG + Intergenic
915033967 1:152907318-152907340 TCTCTGTGTACCATATCTAAAGG - Intergenic
916073238 1:161184209-161184231 ACTGTCTAGGTCAGATCTAAGGG - Intergenic
917462476 1:175244356-175244378 TCTCTGTATGTCAGATCTAATGG + Intergenic
918700995 1:187607661-187607683 TCTCTCTATGCCAATTCTAAGGG - Intergenic
918755965 1:188339653-188339675 TCTCTCTATGTCAGAACTGTCGG - Intergenic
918958018 1:191236166-191236188 TCTCTGTATGTCAGATCTATCGG + Intergenic
919881163 1:201901823-201901845 TTTCTGTATCTCAGAACTATTGG - Intronic
920060059 1:203221158-203221180 TCTCTGTATGTCAGCTGGAGTGG - Intronic
920197174 1:204236500-204236522 TCTCTGCATGTCAGATCTAACGG + Intronic
920425270 1:205870049-205870071 TCTCTCCATGTCAGATCAAAGGG + Intergenic
920946695 1:210535890-210535912 GCTCTGTAATTCAGAGCTAAAGG - Intronic
922851539 1:228737136-228737158 TATCTCTATGTCAGGTCAAAAGG - Intronic
1065246108 10:23759605-23759627 TCTCTGAATGTCTGATTTCAGGG + Intronic
1066957558 10:42187539-42187561 TCTCTGTATGTCAGATCTAATGG + Intergenic
1067332902 10:45338352-45338374 TCTCTGCATATCAGATCCAATGG + Intergenic
1067754600 10:48995581-48995603 CCTATGCATGCCAGATCTAATGG - Intergenic
1067927196 10:50521793-50521815 TCTCTGGATATCACATCTAAAGG + Intronic
1069116878 10:64517979-64518001 TCTCTGCAAGACAAATCTAATGG - Intergenic
1069276840 10:66602659-66602681 TCTATGTGTGTCAGATATATTGG - Intronic
1069314578 10:67081115-67081137 GCTCTGTCTGTCAGAACTGAAGG - Intronic
1069791111 10:71021601-71021623 CTCTTGTATGTCAGATCTAACGG - Intergenic
1070016893 10:72542639-72542661 TCTGTGGATGGCAGAGCTAAAGG - Intronic
1070577327 10:77689037-77689059 TCTCTTTACTTCAGTTCTAAGGG - Intergenic
1072888908 10:99303984-99304006 TCTCTGGATGCCTAATCTAAGGG - Intergenic
1073979457 10:109137912-109137934 TCTGTGTGTGTCAGCTCTATAGG + Intergenic
1076927662 10:133501092-133501114 TCTCTGTATGTCAGATCTAATGG - Intergenic
1077563367 11:3280324-3280346 TCTTTGTTTGGCAGATGTAAGGG + Intergenic
1077569259 11:3326139-3326161 TCTTTGTTTGGCAGATGTAAGGG + Intergenic
1078983888 11:16570274-16570296 TGACTGTATGTCAGGTCTCATGG - Intronic
1081204977 11:40264528-40264550 TCTCTGTCTGTTAGATAAAAAGG + Intronic
1081608791 11:44545973-44545995 TCTCTGTATTTCAGATCTAATGG + Intergenic
1082110266 11:48266403-48266425 TCTCTGAATTTCAAATCTGAGGG + Intergenic
1083914936 11:65735791-65735813 TCTCTGGATACCTGATCTAAGGG + Intergenic
1086554010 11:88088055-88088077 TCTCTAGATATCTGATCTAAGGG + Intergenic
1086823486 11:91466382-91466404 TCTCTGTATTTAAGCCCTAAAGG + Intergenic
1087373813 11:97318880-97318902 TCTCTGTATGTCAGATCTAATGG + Intergenic
1088264903 11:107979671-107979693 TCTCTATATGTCAGATCTAATGG + Intergenic
1089823931 11:121254892-121254914 TCTCTGTATATAATATGTAATGG - Intergenic
1089903375 11:122011748-122011770 TCTCTGTATGTCACATCTAATGG + Intergenic
1091214034 11:133889285-133889307 TCTCTCTCTGTCAGATCAACTGG - Intergenic
1092574132 12:9760606-9760628 TCTATGTATGTGATATCTAATGG - Intronic
1093036050 12:14333460-14333482 TCTCTGTATGTCAGATCTAACGG + Intergenic
1093049173 12:14486836-14486858 TCTCTGTATGTCAGATCTAACGG - Intronic
1093932805 12:24971192-24971214 TCTCTGGATGCCTGATCTAAGGG - Intergenic
1095556876 12:43517687-43517709 ACTCTGTATGTAAAATTTAAAGG + Intronic
1097076615 12:56399613-56399635 TCTGTGTATGTCAGATCTAACGG + Intergenic
1097821643 12:64134081-64134103 TCTCTGTATGTCAGATCTAACGG - Intronic
1097843612 12:64344641-64344663 TCTCTGTATGTCAGATCTAACGG - Intronic
1098296857 12:69012629-69012651 TGTTTGTTTGACAGATCTAATGG - Intergenic
1098749594 12:74277614-74277636 TCTCTGTATGTCAGATCTAACGG + Intergenic
1099859641 12:88210501-88210523 TCTCTGTATGTCAGATCTAAGGG - Intergenic
1100698284 12:97119193-97119215 TCCCTGACTGTCAGATCCAAAGG + Intergenic
1100845101 12:98650141-98650163 TCTCTGTATGACACTTCTAGGGG + Intronic
1101263871 12:103064227-103064249 TCTCTGTATGTCAGTTCTAAAGG + Intergenic
1101902016 12:108797967-108797989 TCTGTGGATGGCAGAGCTAAAGG + Intronic
1102585297 12:113918759-113918781 TCTCTGCAAGCCAGACCTAAGGG - Intronic
1102735829 12:115158666-115158688 TCTCTGAATCTCAGTTCCAATGG - Intergenic
1103035322 12:117651855-117651877 TCTCTGTATGTCAGATCTAATGG + Intronic
1105700180 13:22929870-22929892 TCTCTGTAGGTCAGACCTTACGG - Intergenic
1105852957 13:24351820-24351842 TCTCTGTAGGTCAGACCTTATGG - Intergenic
1107424017 13:40275161-40275183 TCTCTGCAGGGCAGATTTAAGGG + Intergenic
1108037646 13:46308423-46308445 TCTCTGTATGTGAAATATAAAGG - Intergenic
1109185874 13:59267462-59267484 TCTCAGTGTGTCAGATCAAGGGG + Intergenic
1111430777 13:88145972-88145994 TCTCTGGATACCTGATCTAAGGG + Intergenic
1114758513 14:25285737-25285759 TCTCTGTATGTCAGATCTAATGG - Intergenic
1115002354 14:28438487-28438509 TCTCTGGATACCTGATCTAAGGG + Intergenic
1116161365 14:41270026-41270048 TCTCTGGATATCTGATTTAAGGG - Intergenic
1116473667 14:45315270-45315292 TCTCTGCATGTGAGAGGTAAGGG - Intergenic
1116692887 14:48133296-48133318 TCATTGTATGTCAGTTTTAAGGG + Intergenic
1117276391 14:54198333-54198355 TCTCAGGCTGTCAGACCTAATGG - Intergenic
1119059949 14:71464028-71464050 TCTCTGTATGTCAGATCTCATGG - Intronic
1119107823 14:71940722-71940744 TCTCTGTATGTCAGATCTAATGG - Intronic
1119462800 14:74823341-74823363 TTTCTGTATGTTAGGTCTAATGG + Intronic
1119709147 14:76808913-76808935 TCTTGGCATGTCAGATCTAGAGG - Intronic
1120626117 14:86828904-86828926 TCTCTGTATTTGAGATATTATGG - Intergenic
1121915001 14:97830691-97830713 TCTATCTAAGTCGGATCTAAAGG + Intergenic
1122669844 14:103362521-103362543 TTTCTGTAAGACAGATCTAGTGG + Intergenic
1122841694 14:104467834-104467856 TCCCTGTAAGTCAGACCTTATGG - Intergenic
1202935542 14_KI270725v1_random:84227-84249 TCTCTGTATGTCAGTTCTAATGG - Intergenic
1124121014 15:26888657-26888679 TGTATGTATGTCAGATCTGGTGG - Intronic
1124718828 15:32094063-32094085 CCTCTGTTTGTCAGGTTTAACGG + Intronic
1125757944 15:42077717-42077739 TCTCTGGATACCTGATCTAAGGG - Intronic
1130580320 15:85131765-85131787 TTTTTGTAGGTCAGGTCTAATGG + Intronic
1131879603 15:96848908-96848930 TCTCTGAAGGTTAGACCTAAGGG + Intergenic
1132190035 15:99846515-99846537 TCTCAGAATGTCAGCTATAATGG + Intergenic
1140009629 16:71118282-71118304 TCTGGGGATGTGAGATCTAAAGG - Intronic
1140012252 16:71145884-71145906 TCTCTATCTGTAAAATCTAAGGG + Intronic
1144220055 17:13091723-13091745 TTTCTGTAAGTCAGATTTATAGG + Intergenic
1146850677 17:36219146-36219168 TCTCTGTATGTCAGATCTAACGG + Intronic
1151198512 17:72450006-72450028 TCTCAGTATGTCACATCTGGAGG - Intergenic
1153061477 18:999477-999499 TCTCTGTATTTCTGAAATAAAGG - Intergenic
1153217954 18:2837489-2837511 TCTCTGTATGTCAGAGCTAATGG - Intergenic
1155680826 18:28483551-28483573 TCTCTGGATTCCTGATCTAAGGG - Intergenic
1156192297 18:34733592-34733614 TCTCTGTATGTCAGATCTAATGG - Intronic
1156537542 18:37878645-37878667 TCTGTGTACATCAGATCTAATGG + Intergenic
1156727170 18:40142488-40142510 ACTCTCAATGTCAGATCTAAAGG - Intergenic
1157046052 18:44103104-44103126 TCTCTGGATACCTGATCTAAGGG + Intergenic
1158106833 18:53895120-53895142 TCTTTCTATGTCAGGACTAAAGG - Intergenic
1159099203 18:63939565-63939587 TCTCTGTATCTCAGATGAATGGG - Intergenic
1159249442 18:65854835-65854857 TCTATGTAAGTCATATCTAATGG - Intronic
1160278157 18:77459112-77459134 TCTCTAGATGTCTGATCAAAAGG + Intergenic
1161731103 19:5961092-5961114 TCTGTGGAGGCCAGATCTAAGGG - Intronic
1164254719 19:23517453-23517475 CCTCTTTCTGTCAGCTCTAAAGG - Intergenic
925301609 2:2818063-2818085 TCCCTTTAAGTCAGATCTAATGG - Intergenic
925677593 2:6381655-6381677 TTTCTGAATGTCAAATATAAAGG - Intergenic
926810638 2:16752563-16752585 TCTGTATATGTCAGATCTAACGG - Intergenic
927724955 2:25414984-25415006 TCTGTTTTTCTCAGATCTAAGGG - Intronic
929184379 2:39078561-39078583 GCTCTGTCTGTCAGATCAATAGG + Intronic
930536836 2:52654137-52654159 TCTCTGTGTGTCAGATCTAATGG - Intergenic
931291187 2:60875207-60875229 TCTCTGTGTTTCACAGCTAAAGG - Intergenic
932116830 2:69058426-69058448 TCTCTGTCTGTCCTATCTAAAGG + Intronic
932207800 2:69899066-69899088 TTCCTGAAAGTCAGATCTAAGGG + Intronic
934116793 2:88806563-88806585 TCTTTGCATGTCACATTTAATGG - Intergenic
934305670 2:91820053-91820075 TCTCTGTATGTCAGATCTAATGG + Intergenic
934327586 2:92032689-92032711 TCTCTGTATGTCAGATCTAATGG - Intergenic
934465973 2:94263268-94263290 TCTCTGTATGTCAGATCTAATGG - Intergenic
935425345 2:102913207-102913229 TCTTTGTATGTCAGATCTAACGG - Intergenic
937138757 2:119579325-119579347 TCATTGTATATCAGATTTAATGG + Intronic
938709385 2:133962897-133962919 TCTCTGTAGATCAGATATCAGGG + Intergenic
939639838 2:144627208-144627230 TTACTGGATGTCAGATTTAATGG + Intergenic
940472333 2:154114986-154115008 TCTCCATATGTCAGATCTAACGG - Intronic
943239451 2:185364475-185364497 TCTCTGTATGTCAGATCTGATGG - Intergenic
943517846 2:188909121-188909143 TCTCTGTAGGTCAGATCTAATGG - Intergenic
945777400 2:214124085-214124107 TCACTGTAGGTCAGAACTGAAGG + Intronic
946528114 2:220541846-220541868 TTTCTGTATGTCAGATCTAATGG - Intergenic
1169915300 20:10676758-10676780 TCTCTGTATTTCAGTTCTCTCGG - Intergenic
1170052046 20:12156680-12156702 ATTCTGTATGTCAGCTCTATGGG - Intergenic
1170358779 20:15521573-15521595 TCTCTGTCTCCCAGATCCAAAGG - Intronic
1174949373 20:55027758-55027780 TCTCTGTATGCCTTATCTAAGGG + Intergenic
1175437566 20:58964990-58965012 TTTCTGCATGACAGATCTACTGG - Intergenic
1176596967 21:8706463-8706485 TCTCTGTATGTCAGTTCTAATGG - Intergenic
1176975790 21:15320167-15320189 TCTATGTATGTAATAACTAATGG + Intergenic
1177505856 21:22016402-22016424 TCTCTCTATTTCAGATCTAACGG - Intergenic
1177912945 21:27054347-27054369 TCTCTGTATGTGAGATCTAACGG + Intergenic
1177933935 21:27318803-27318825 TCTCTGTAGGTCAGATCTAATGG - Intergenic
1178764068 21:35432815-35432837 TTTCTGTATGTCAGATCTAACGG - Intronic
1179214517 21:39355431-39355453 TCTGTGTATGTCCGCTCTATTGG - Intergenic
1180279890 22:10683905-10683927 TCTCTGTATGTCAGTTCTAATGG - Intergenic
1180587107 22:16902441-16902463 TCTCTGTATGTCAGATCTAATGG - Intergenic
1180591389 22:16940259-16940281 TCTCTGTATGTCAAATCTAATGG - Intergenic
1182964753 22:34510568-34510590 TCTCTGGATGCCTGATCTAAGGG - Intergenic
1183237777 22:36632586-36632608 CCTCTGCTTGTCAGATCTGATGG + Intronic
1185247074 22:49778631-49778653 CCTCTGGGTGTCAGAGCTAAAGG + Intronic
949144831 3:686530-686552 TTTTTGAATTTCAGATCTAAAGG - Intergenic
949417899 3:3833071-3833093 TCTCTGTATGTCAGATCTAACGG - Intronic
949445366 3:4129161-4129183 TCTCTGCATGTCATATCTAACGG + Intronic
949638538 3:6010647-6010669 TCTCTGTATGTCAGATCTAACGG + Intergenic
949881325 3:8663339-8663361 TCTCTGTATGTCAGACAGGAGGG - Intronic
951095144 3:18620561-18620583 TGTCTGTATGTCAGCTTCAAGGG - Intergenic
952720675 3:36529510-36529532 TCTCTGTATGTCTAATCTAGAGG + Intronic
952733620 3:36665962-36665984 TCTCTATATGTAAGACTTAAAGG + Intergenic
954053869 3:48005816-48005838 TCTCTGCATGTCAGACCTAATGG + Intronic
954318463 3:49814077-49814099 TCTCTGAGTGTCAGACCTGAGGG + Intergenic
954583119 3:51714128-51714150 ACTCTGAATGTCAGTTCTATTGG - Intronic
955035338 3:55262211-55262233 TCTCTGTATGTCAGATCCAATGG + Intergenic
955118089 3:56025872-56025894 TCTCTGTATAAGAGATCTAAAGG - Intronic
955913945 3:63887160-63887182 TCCCTGTATCTCACACCTAACGG - Intronic
957247783 3:77735215-77735237 TCTCTGTATGCCATATCTAATGG - Intergenic
957859863 3:85932944-85932966 ATTCTGTGTGTCAGATCTAAAGG + Intronic
958595395 3:96216101-96216123 TCTCTGTATACCTAATCTAAGGG + Intergenic
959774016 3:110134994-110135016 TCTGTGGATGGCAGAGCTAAGGG + Intergenic
960349321 3:116574108-116574130 TCTCTGTATGTCAGATCTAATGG + Intronic
962281322 3:134054031-134054053 GCTCTCTATGCCAGATCCAAGGG + Intergenic
962533264 3:136303162-136303184 TCCCTATATGTCAAATGTAATGG + Intronic
962892789 3:139687243-139687265 TCTCTGGATCTCAGACCAAAAGG + Intergenic
963429570 3:145181360-145181382 TCTCTGAATACCTGATCTAAGGG + Intergenic
964939175 3:162133698-162133720 TCTCTGCAGGTCAGAGATAAAGG - Intergenic
965969917 3:174542394-174542416 TCTCTGGATGCCTGATCTAAGGG + Intronic
966128291 3:176606211-176606233 TCTCTGTATGTTAGAACAGAAGG - Intergenic
967036192 3:185649799-185649821 TTTCTGTGTGTCAGGGCTAAGGG + Intronic
967526248 3:190496937-190496959 TTTCTGTATGTCAGGACAAATGG - Intergenic
967831523 3:193924102-193924124 TCTCTCTATGTCAGATCTGATGG + Intergenic
968172136 3:196519138-196519160 TCTCTGTGTGTCAAATGTGAGGG + Intergenic
968598532 4:1497911-1497933 TCTGTGGATGGCAGAGCTAAAGG - Intergenic
970014451 4:11497858-11497880 GCTCTGTATGTCAGATATTTAGG - Intergenic
971733305 4:30414280-30414302 TCTCTGTAGGGCATTTCTAATGG - Intergenic
971787661 4:31125365-31125387 TCTCTGGATGTCAGATATAGTGG - Intronic
972084993 4:35205148-35205170 TCTCTGTATGTCAGATCTAACGG + Intergenic
972392930 4:38630566-38630588 TCTCTGGATCTCAGTTCTGAGGG + Intergenic
972768629 4:42174779-42174801 ACTCTGTATGTCAGGCCTGAGGG + Intergenic
975170241 4:71224498-71224520 TCTCTGTATTTCAGATATGATGG + Intronic
977844816 4:101756475-101756497 TTTCTGTATTTCAGATCTCGTGG + Intronic
977930632 4:102745383-102745405 TCTCTGTATGTCAGATCTAACGG - Intronic
978595877 4:110376467-110376489 TCTCTGTGTGGCTAATCTAATGG - Intronic
980233810 4:130078090-130078112 TCTCTGTCTGTCAGATGCACGGG - Intergenic
980291966 4:130855683-130855705 TTTCCATATGTCAGTTCTAATGG - Intergenic
982756462 4:159224789-159224811 TCTCTGTGTGCCAAAGCTAAGGG + Intronic
983127310 4:163970034-163970056 TCTGAATATGTGAGATCTAATGG - Intronic
984169726 4:176345195-176345217 TCCCTGTTTGACAGAACTAAAGG - Intergenic
985226087 4:187763370-187763392 TCTCTGTAGGCCAGACCTTACGG - Intergenic
986049452 5:4075098-4075120 TGTCTGTAAGGCAAATCTAATGG + Intergenic
987578601 5:19760221-19760243 TCTCTGTGTATCAGATCTAATGG - Intronic
987621581 5:20343021-20343043 TCTCTGTATGTCAGATCTAACGG + Intronic
987882372 5:23765402-23765424 TCTTTGTATGTGAAACCTAAAGG - Intergenic
988029988 5:25751850-25751872 TATCTGGATGCCAGATCTAAGGG + Intergenic
988169431 5:27634702-27634724 TTTCTGTATGTCAGATCTAATGG - Intergenic
988188540 5:27899362-27899384 TCTTTGTAAGTCAGATCTAATGG + Intergenic
989486627 5:41998263-41998285 TCTCTGTATATCAGATCTAATGG - Intergenic
989959821 5:50399106-50399128 ACGATATATGTCAGATCTAAAGG - Exonic
990706361 5:58534209-58534231 TCTCTGTACCTCAGCTATAAAGG + Intergenic
991060947 5:62375219-62375241 TTTCTGTGTGTGAGATGTAAAGG + Intronic
991945895 5:71898253-71898275 TCTCTATATGTCAGATATAATGG + Intergenic
993791545 5:92217033-92217055 TCTCTGTATGTCAGAGGTAACGG + Intergenic
994836887 5:104866268-104866290 TCTCTGTATGTCAGATCTAATGG + Intergenic
994984665 5:106917611-106917633 TCTCTGTATGTCAGACTTAATGG - Intergenic
997051746 5:130389680-130389702 TCTCTGTATGTCTGAAATAATGG + Intergenic
997508338 5:134435868-134435890 ACTCTGTATGGAAGCTCTAAGGG + Intergenic
999265327 5:150263721-150263743 TCTCTGACTGTAAGATCTTATGG - Intronic
999862905 5:155667610-155667632 TGTCTCAATGTCAGAGCTAAAGG - Intergenic
1001220147 5:169893619-169893641 GCTCTGTGTGTCAGATGGAAGGG + Intronic
1004824546 6:19405117-19405139 TTTCCGTACGTCAGATCTAATGG - Intergenic
1005149881 6:22736625-22736647 TCTCTGAATTTTAGATCTAAGGG - Intergenic
1005686141 6:28254683-28254705 TCTCTGGATACCATATCTAAAGG + Intergenic
1006797523 6:36741233-36741255 CCTCAGGATGTCAGACCTAAAGG + Exonic
1008353081 6:50516624-50516646 TGGCTGTATTTCAGCTCTAAGGG - Intergenic
1008914091 6:56767948-56767970 TCTCTTTATTTCATACCTAATGG - Intronic
1009931157 6:70178993-70179015 TCTCTTTGTCTCAGATCTCAAGG + Intronic
1010733231 6:79412858-79412880 TCTGTGGATGGCAGAGCTAAAGG - Intergenic
1010818346 6:80386200-80386222 TCTCTAGATGTCAGATCTAATGG + Intergenic
1010818376 6:80386517-80386539 TCTCTGGATGTCAGATCTAATGG + Intergenic
1010869485 6:81020361-81020383 TCTCTGGATACCTGATCTAAAGG + Intergenic
1012395572 6:98792613-98792635 TCTGTGTGTGTAAGATATAAAGG - Intergenic
1013484562 6:110584373-110584395 TATTTGTATTTCAGATTTAAGGG + Intergenic
1014456085 6:121636444-121636466 TCTCTGTATGTCAGATCTAATGG - Intergenic
1014534450 6:122598510-122598532 TCTCTGTATGTCAGATCTAATGG - Intronic
1015078998 6:129200754-129200776 TCTATGTATGTGATATCTATGGG - Intronic
1017113407 6:150953525-150953547 TCTCTGAATGATAGAACTAAAGG - Intronic
1019002743 6:168769199-168769221 TCTCTGTCAGCCAGATCTTACGG + Intergenic
1019523733 7:1471633-1471655 TCTCTCTGTGTCAGATCTGCTGG - Exonic
1019995686 7:4722986-4723008 TGTCTGGATCTCAGATCTGAGGG - Intronic
1020536732 7:9407605-9407627 TCTCAGCATGTCTGATATAAAGG - Intergenic
1021556797 7:21927906-21927928 TCTCTGCCTGCCAGCTCTAAAGG + Intronic
1023444119 7:40214522-40214544 TCTTTGTGTGTCAGAACTTAGGG + Intronic
1025761922 7:64403620-64403642 TCTCTGTATGTCAGATCTAATGG + Intergenic
1028963758 7:96778611-96778633 TCTCATTATTTCAGATCTCACGG + Intergenic
1029983454 7:104900559-104900581 AATCGGTATGTCAGATCCAAAGG + Intronic
1031327933 7:120425613-120425635 TCTCTGTAACTCAGTTCTACTGG + Intronic
1031805829 7:126304969-126304991 TCTCTGGATTCCTGATCTAAGGG - Intergenic
1032153364 7:129448823-129448845 TCTCCTTATGCCAGAGCTAATGG - Intronic
1032923669 7:136577683-136577705 TCTCTGTATGTCAGATATAATGG - Intergenic
1033252297 7:139771303-139771325 ATTCTGTTTGTCAGATCTACGGG + Intronic
1033268687 7:139911376-139911398 ACACTGCATGTCAGATCCAATGG + Intronic
1036989350 8:13575265-13575287 GCTCTGGATGTCAGGACTAATGG + Intergenic
1040916393 8:52569724-52569746 TTTCTGTATGTCAGATCTAATGG - Intergenic
1041640090 8:60189040-60189062 TCTCATTCTGTCACATCTAACGG + Exonic
1041970408 8:63734779-63734801 TATCTGTATGTGAAAACTAATGG + Intergenic
1042272679 8:66971052-66971074 TCTCTGTATTTCAGAGAAAAAGG + Intronic
1043243073 8:77961173-77961195 TTTCTGGATGTCATATCTTATGG - Intergenic
1048274836 8:133058357-133058379 TCTCTCTATGTCTGTTCTAGAGG + Intronic
1048671564 8:136729008-136729030 TGTCTTTCTGGCAGATCTAAAGG + Intergenic
1049482334 8:142832413-142832435 TCTCTGGATGCCTGATCTAAGGG - Intergenic
1049495571 8:142930076-142930098 TCTTTCTATGTCAGATTTAGTGG + Intergenic
1051966167 9:22832349-22832371 TCTCTGTATGTCAGATCTAATGG + Intergenic
1053696028 9:40640045-40640067 TCTCTGTATGTCAGATCTAATGG - Intergenic
1054307275 9:63439263-63439285 TCTCTGTATGTCAGATCTAATGG - Intergenic
1054406006 9:64763255-64763277 TCTCTGTATGTCAGATCTAATGG - Intergenic
1054439632 9:65248742-65248764 TCTCTGTATGTCAGATCTAATGG - Intergenic
1054490775 9:65773197-65773219 TCTCTGTATGTCAGATCTAATGG + Intergenic
1056725617 9:89112656-89112678 TCTCTTTATCTCAAATCTCAGGG - Intronic
1057938482 9:99259915-99259937 TTTCTGGATGTCAAATCTCACGG + Intergenic
1060278234 9:122198311-122198333 CCTCTGTATTTCAGCTCTCAGGG + Intronic
1202778475 9_KI270717v1_random:13658-13680 TCTCTGTATGTCAGATCTAATGG - Intergenic
1203585553 Un_KI270747v1:57-79 TCTCTGTATGTCAGATCTAATGG - Intergenic
1186470027 X:9813972-9813994 TCCCTGTATGTCAGATCTAATGG - Intronic
1188113282 X:26216452-26216474 CCTCTTTATGTCAGGTCTATGGG + Intronic
1188887778 X:35571538-35571560 TCTGTATATTTCAGATCAAACGG - Intergenic
1189078971 X:37948951-37948973 TTTCTGTATGTAAACTCTAAAGG + Intronic
1189167087 X:38870829-38870851 TCTCTGCATGTCAGAGGTAAGGG + Intergenic
1189207338 X:39253303-39253325 CCTCAGTAGGTCAGTTCTAATGG - Intergenic
1190707736 X:53044661-53044683 TCTCTGGATGCCTGGTCTAAGGG - Intergenic
1191113406 X:56826629-56826651 TCTCTGTAGGACAGATCTTACGG - Intergenic
1191155946 X:57272721-57272743 GCTCTGTAAGGCAGATCTAGCGG - Intergenic
1191742769 X:64453192-64453214 TCTCCGTATCTCAGATCTAATGG - Intergenic
1191837038 X:65475321-65475343 TCTTTGTAAGGCAGATCTAGTGG + Intronic
1191946123 X:66537121-66537143 TCTTTGTATGTCAGATCTAAGGG + Intergenic
1192297961 X:69869878-69869900 TCTCTGTATGTCAGATCTAATGG - Intronic
1192715485 X:73637044-73637066 TTTTTGTAGGGCAGATCTAATGG + Intronic
1193053181 X:77123297-77123319 TCTCTGAATTTCAGATCTAACGG + Intergenic
1193185398 X:78506385-78506407 TTGCTGTATTTCAGATCTTAGGG - Intergenic
1193737618 X:85178124-85178146 TCTCAGTATGTCATATGTCAAGG + Intergenic
1193904359 X:87224673-87224695 TCTCTGTATGTCACATCTAATGG + Intergenic
1194032241 X:88831746-88831768 TCTCTGTATGTCAGATCTAACGG - Intergenic
1194520870 X:94917545-94917567 TCTCTTTATGCCAGATCTTATGG + Intergenic
1194570934 X:95553839-95553861 TCTCTGGATGCCTGATCTAAGGG + Intergenic
1195782615 X:108481759-108481781 TCTCTGTATGTCAGATCTAATGG - Intronic
1195809906 X:108817717-108817739 TCCCTGCATGTCAGATCTAATGG - Intergenic
1197591613 X:128417452-128417474 TCTCTGTATGTCAGACATAATGG + Intergenic
1197890914 X:131269467-131269489 TCTCTATGTGTCAGATCTATAGG - Intergenic
1198272642 X:135068847-135068869 TTTCTGGATATCTGATCTAACGG - Intergenic
1199001794 X:142647539-142647561 TCTCTAGATGACAAATCTAAGGG - Intergenic
1199508379 X:148592041-148592063 CCTCGTTATGTCAGATCTGAGGG + Intronic
1199627329 X:149752485-149752507 TTTCTGTATGTCAGATCTAATGG - Intergenic
1199831431 X:151552376-151552398 TCAGTGTATTTCAGATGTAATGG + Intergenic
1199978521 X:152908213-152908235 TCTCTGGGTGTCAGGGCTAATGG + Intergenic
1200319534 X:155172584-155172606 CCACTTCATGTCAGATCTAATGG - Intergenic
1200973302 Y:9179438-9179460 TCTGTGTATGTCAGATTTAATGG - Intergenic
1200976480 Y:9217033-9217055 TCTCTGTATGTCAGATCTAAGGG + Intergenic
1201193787 Y:11471957-11471979 TCTCTGTATGTCAGATCTAATGG - Intergenic
1201798214 Y:17924814-17924836 TCTCTGTGTGTCAGATCTAAGGG + Intergenic
1201803339 Y:17981143-17981165 TCTCTGTGTGTCAGATCTAAGGG - Intergenic
1202100196 Y:21299537-21299559 TCTCTGTATGTCAGATCTAACGG + Intergenic
1202134690 Y:21649498-21649520 TCTCTGTATGTCAGATCTAAGGG - Intergenic
1202137775 Y:21685074-21685096 TCTGTGTATGTCAGATTTAATGG + Intergenic
1202359538 Y:24093505-24093527 TCTCTGTGTGTCAGATCTAAGGG + Intergenic
1202511240 Y:25576609-25576631 TCTCTGTGTGTCAGATCTAAGGG - Intergenic