ID: 1099859643

View in Genome Browser
Species Human (GRCh38)
Location 12:88210515-88210537
Sequence ATACAGAGAAGAGTAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099859639_1099859643 -5 Left 1099859639 12:88210497-88210519 CCCACCCTTAGATCTGACATACA No data
Right 1099859643 12:88210515-88210537 ATACAGAGAAGAGTAATTACAGG No data
1099859640_1099859643 -6 Left 1099859640 12:88210498-88210520 CCACCCTTAGATCTGACATACAG No data
Right 1099859643 12:88210515-88210537 ATACAGAGAAGAGTAATTACAGG No data
1099859641_1099859643 -9 Left 1099859641 12:88210501-88210523 CCCTTAGATCTGACATACAGAGA 0: 45
1: 35
2: 21
3: 35
4: 180
Right 1099859643 12:88210515-88210537 ATACAGAGAAGAGTAATTACAGG No data
1099859642_1099859643 -10 Left 1099859642 12:88210502-88210524 CCTTAGATCTGACATACAGAGAA No data
Right 1099859643 12:88210515-88210537 ATACAGAGAAGAGTAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099859643 Original CRISPR ATACAGAGAAGAGTAATTAC AGG Intergenic
No off target data available for this crispr