ID: 1099859644

View in Genome Browser
Species Human (GRCh38)
Location 12:88210516-88210538
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099859639_1099859644 -4 Left 1099859639 12:88210497-88210519 CCCACCCTTAGATCTGACATACA No data
Right 1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG No data
1099859642_1099859644 -9 Left 1099859642 12:88210502-88210524 CCTTAGATCTGACATACAGAGAA No data
Right 1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG No data
1099859641_1099859644 -8 Left 1099859641 12:88210501-88210523 CCCTTAGATCTGACATACAGAGA No data
Right 1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG No data
1099859640_1099859644 -5 Left 1099859640 12:88210498-88210520 CCACCCTTAGATCTGACATACAG No data
Right 1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099859644 Original CRISPR TACAGAGAAGAGTAATTACA GGG Intergenic