ID: 1099861846

View in Genome Browser
Species Human (GRCh38)
Location 12:88231865-88231887
Sequence GTGTCTACACAGAAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099861846_1099861848 16 Left 1099861846 12:88231865-88231887 CCTGCACACTTCTGTGTAGACAC No data
Right 1099861848 12:88231904-88231926 ATACCTTTTCCAAACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099861846 Original CRISPR GTGTCTACACAGAAGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr