ID: 1099864629

View in Genome Browser
Species Human (GRCh38)
Location 12:88264210-88264232
Sequence AAGAAATTTTGTGATTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099864629_1099864633 22 Left 1099864629 12:88264210-88264232 CCAATCTAATCACAAAATTTCTT No data
Right 1099864633 12:88264255-88264277 GTGATGGCAGAGGTAGAGTTTGG No data
1099864629_1099864631 6 Left 1099864629 12:88264210-88264232 CCAATCTAATCACAAAATTTCTT No data
Right 1099864631 12:88264239-88264261 CGGAGTCAGAGAACACGTGATGG No data
1099864629_1099864632 12 Left 1099864629 12:88264210-88264232 CCAATCTAATCACAAAATTTCTT No data
Right 1099864632 12:88264245-88264267 CAGAGAACACGTGATGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099864629 Original CRISPR AAGAAATTTTGTGATTAGAT TGG (reversed) Intergenic