ID: 1099864629 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:88264210-88264232 |
| Sequence | AAGAAATTTTGTGATTAGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1099864629_1099864632 | 12 | Left | 1099864629 | 12:88264210-88264232 | CCAATCTAATCACAAAATTTCTT | No data | ||
| Right | 1099864632 | 12:88264245-88264267 | CAGAGAACACGTGATGGCAGAGG | No data | ||||
| 1099864629_1099864633 | 22 | Left | 1099864629 | 12:88264210-88264232 | CCAATCTAATCACAAAATTTCTT | No data | ||
| Right | 1099864633 | 12:88264255-88264277 | GTGATGGCAGAGGTAGAGTTTGG | No data | ||||
| 1099864629_1099864631 | 6 | Left | 1099864629 | 12:88264210-88264232 | CCAATCTAATCACAAAATTTCTT | No data | ||
| Right | 1099864631 | 12:88264239-88264261 | CGGAGTCAGAGAACACGTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1099864629 | Original CRISPR | AAGAAATTTTGTGATTAGAT TGG (reversed) | Intergenic | ||