ID: 1099864631

View in Genome Browser
Species Human (GRCh38)
Location 12:88264239-88264261
Sequence CGGAGTCAGAGAACACGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099864629_1099864631 6 Left 1099864629 12:88264210-88264232 CCAATCTAATCACAAAATTTCTT No data
Right 1099864631 12:88264239-88264261 CGGAGTCAGAGAACACGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099864631 Original CRISPR CGGAGTCAGAGAACACGTGA TGG Intergenic
No off target data available for this crispr