ID: 1099868076

View in Genome Browser
Species Human (GRCh38)
Location 12:88309543-88309565
Sequence GAGGAGAAAGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099868076_1099868081 -2 Left 1099868076 12:88309543-88309565 CCCTCCTCCTTCTCTTTCTCCTC No data
Right 1099868081 12:88309564-88309586 TCTTCCTTTTTCCTAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099868076 Original CRISPR GAGGAGAAAGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr