ID: 1099871188

View in Genome Browser
Species Human (GRCh38)
Location 12:88351293-88351315
Sequence CTTGTATTTTACATCTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099871186_1099871188 5 Left 1099871186 12:88351265-88351287 CCCTAATTTATCATCAAATTTTG No data
Right 1099871188 12:88351293-88351315 CTTGTATTTTACATCTCTATTGG No data
1099871187_1099871188 4 Left 1099871187 12:88351266-88351288 CCTAATTTATCATCAAATTTTGT No data
Right 1099871188 12:88351293-88351315 CTTGTATTTTACATCTCTATTGG No data
1099871185_1099871188 8 Left 1099871185 12:88351262-88351284 CCTCCCTAATTTATCATCAAATT No data
Right 1099871188 12:88351293-88351315 CTTGTATTTTACATCTCTATTGG No data
1099871184_1099871188 13 Left 1099871184 12:88351257-88351279 CCATACCTCCCTAATTTATCATC No data
Right 1099871188 12:88351293-88351315 CTTGTATTTTACATCTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099871188 Original CRISPR CTTGTATTTTACATCTCTAT TGG Intergenic
No off target data available for this crispr