ID: 1099881459

View in Genome Browser
Species Human (GRCh38)
Location 12:88471954-88471976
Sequence AGAAGGAAGTGTGTCTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099881459_1099881461 0 Left 1099881459 12:88471954-88471976 CCTCTTTAGACACACTTCCTTCT No data
Right 1099881461 12:88471977-88471999 TGCTCAGCAAAACTGCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099881459 Original CRISPR AGAAGGAAGTGTGTCTAAAG AGG (reversed) Intergenic
No off target data available for this crispr