ID: 1099905121

View in Genome Browser
Species Human (GRCh38)
Location 12:88762000-88762022
Sequence CCTCATGGAGAGTCTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099905121_1099905127 7 Left 1099905121 12:88762000-88762022 CCTAGCAGAGACTCTCCATGAGG No data
Right 1099905127 12:88762030-88762052 CCTTGCAGCAAACTTCTGCCTGG No data
1099905121_1099905128 16 Left 1099905121 12:88762000-88762022 CCTAGCAGAGACTCTCCATGAGG No data
Right 1099905128 12:88762039-88762061 AAACTTCTGCCTGGAAATCCAGG 0: 11
1: 590
2: 1540
3: 1832
4: 1714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099905121 Original CRISPR CCTCATGGAGAGTCTCTGCT AGG (reversed) Intergenic
No off target data available for this crispr