ID: 1099905127

View in Genome Browser
Species Human (GRCh38)
Location 12:88762030-88762052
Sequence CCTTGCAGCAAACTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099905120_1099905127 19 Left 1099905120 12:88761988-88762010 CCTTTGCACTTTCCTAGCAGAGA No data
Right 1099905127 12:88762030-88762052 CCTTGCAGCAAACTTCTGCCTGG No data
1099905118_1099905127 21 Left 1099905118 12:88761986-88762008 CCCCTTTGCACTTTCCTAGCAGA No data
Right 1099905127 12:88762030-88762052 CCTTGCAGCAAACTTCTGCCTGG No data
1099905125_1099905127 -8 Left 1099905125 12:88762015-88762037 CCATGAGGGCTTTGGCCTTGCAG No data
Right 1099905127 12:88762030-88762052 CCTTGCAGCAAACTTCTGCCTGG No data
1099905119_1099905127 20 Left 1099905119 12:88761987-88762009 CCCTTTGCACTTTCCTAGCAGAG No data
Right 1099905127 12:88762030-88762052 CCTTGCAGCAAACTTCTGCCTGG No data
1099905121_1099905127 7 Left 1099905121 12:88762000-88762022 CCTAGCAGAGACTCTCCATGAGG No data
Right 1099905127 12:88762030-88762052 CCTTGCAGCAAACTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099905127 Original CRISPR CCTTGCAGCAAACTTCTGCC TGG Intergenic
No off target data available for this crispr