ID: 1099905128

View in Genome Browser
Species Human (GRCh38)
Location 12:88762039-88762061
Sequence AAACTTCTGCCTGGAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5687
Summary {0: 11, 1: 590, 2: 1540, 3: 1832, 4: 1714}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099905120_1099905128 28 Left 1099905120 12:88761988-88762010 CCTTTGCACTTTCCTAGCAGAGA No data
Right 1099905128 12:88762039-88762061 AAACTTCTGCCTGGAAATCCAGG 0: 11
1: 590
2: 1540
3: 1832
4: 1714
1099905118_1099905128 30 Left 1099905118 12:88761986-88762008 CCCCTTTGCACTTTCCTAGCAGA No data
Right 1099905128 12:88762039-88762061 AAACTTCTGCCTGGAAATCCAGG 0: 11
1: 590
2: 1540
3: 1832
4: 1714
1099905119_1099905128 29 Left 1099905119 12:88761987-88762009 CCCTTTGCACTTTCCTAGCAGAG No data
Right 1099905128 12:88762039-88762061 AAACTTCTGCCTGGAAATCCAGG 0: 11
1: 590
2: 1540
3: 1832
4: 1714
1099905121_1099905128 16 Left 1099905121 12:88762000-88762022 CCTAGCAGAGACTCTCCATGAGG No data
Right 1099905128 12:88762039-88762061 AAACTTCTGCCTGGAAATCCAGG 0: 11
1: 590
2: 1540
3: 1832
4: 1714
1099905125_1099905128 1 Left 1099905125 12:88762015-88762037 CCATGAGGGCTTTGGCCTTGCAG No data
Right 1099905128 12:88762039-88762061 AAACTTCTGCCTGGAAATCCAGG 0: 11
1: 590
2: 1540
3: 1832
4: 1714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099905128 Original CRISPR AAACTTCTGCCTGGAAATCC AGG Intergenic
Too many off-targets to display for this crispr