ID: 1099909122

View in Genome Browser
Species Human (GRCh38)
Location 12:88808113-88808135
Sequence AATCTATGCAGATATACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099909122_1099909124 14 Left 1099909122 12:88808113-88808135 CCTGCTGTATATCTGCATAGATT No data
Right 1099909124 12:88808150-88808172 CCAGCAAAATATTTGTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099909122 Original CRISPR AATCTATGCAGATATACAGC AGG (reversed) Intergenic
No off target data available for this crispr