ID: 1099913312

View in Genome Browser
Species Human (GRCh38)
Location 12:88860580-88860602
Sequence CATAGGTATAAGGGAAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099913312_1099913322 30 Left 1099913312 12:88860580-88860602 CCCCACTTTCCCTTATACCTATG No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data
1099913312_1099913321 29 Left 1099913312 12:88860580-88860602 CCCCACTTTCCCTTATACCTATG No data
Right 1099913321 12:88860632-88860654 TTGGCTCAAAGACAACATCGTGG No data
1099913312_1099913320 10 Left 1099913312 12:88860580-88860602 CCCCACTTTCCCTTATACCTATG No data
Right 1099913320 12:88860613-88860635 TCTAAATAATGCATTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099913312 Original CRISPR CATAGGTATAAGGGAAAGTG GGG (reversed) Intergenic
No off target data available for this crispr