ID: 1099913322

View in Genome Browser
Species Human (GRCh38)
Location 12:88860633-88860655
Sequence TGGCTCAAAGACAACATCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099913312_1099913322 30 Left 1099913312 12:88860580-88860602 CCCCACTTTCCCTTATACCTATG No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data
1099913315_1099913322 28 Left 1099913315 12:88860582-88860604 CCACTTTCCCTTATACCTATGGG No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data
1099913318_1099913322 20 Left 1099913318 12:88860590-88860612 CCTTATACCTATGGGAAAGAACT No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data
1099913313_1099913322 29 Left 1099913313 12:88860581-88860603 CCCACTTTCCCTTATACCTATGG No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data
1099913319_1099913322 13 Left 1099913319 12:88860597-88860619 CCTATGGGAAAGAACTTCTAAAT No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data
1099913317_1099913322 21 Left 1099913317 12:88860589-88860611 CCCTTATACCTATGGGAAAGAAC No data
Right 1099913322 12:88860633-88860655 TGGCTCAAAGACAACATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099913322 Original CRISPR TGGCTCAAAGACAACATCGT GGG Intergenic
No off target data available for this crispr