ID: 1099921185

View in Genome Browser
Species Human (GRCh38)
Location 12:88959075-88959097
Sequence ATGTGGGAAGGGCCTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099921185_1099921192 3 Left 1099921185 12:88959075-88959097 CCATGGAAAGGCCCTTCCCACAT No data
Right 1099921192 12:88959101-88959123 GCACATTTTCCAGGTCTAAGAGG No data
1099921185_1099921191 -6 Left 1099921185 12:88959075-88959097 CCATGGAAAGGCCCTTCCCACAT No data
Right 1099921191 12:88959092-88959114 CCACATTTGGCACATTTTCCAGG No data
1099921185_1099921195 21 Left 1099921185 12:88959075-88959097 CCATGGAAAGGCCCTTCCCACAT No data
Right 1099921195 12:88959119-88959141 AGAGGGTTTTCATCAGTGAAAGG No data
1099921185_1099921193 4 Left 1099921185 12:88959075-88959097 CCATGGAAAGGCCCTTCCCACAT No data
Right 1099921193 12:88959102-88959124 CACATTTTCCAGGTCTAAGAGGG No data
1099921185_1099921196 22 Left 1099921185 12:88959075-88959097 CCATGGAAAGGCCCTTCCCACAT No data
Right 1099921196 12:88959120-88959142 GAGGGTTTTCATCAGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099921185 Original CRISPR ATGTGGGAAGGGCCTTTCCA TGG (reversed) Intergenic