ID: 1099921601

View in Genome Browser
Species Human (GRCh38)
Location 12:88964511-88964533
Sequence CTGTGTGTCCAGGGGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099921601_1099921607 25 Left 1099921601 12:88964511-88964533 CCTTCTTGCCCCTGGACACACAG No data
Right 1099921607 12:88964559-88964581 AGTCTTATTTATAATCTTAAGGG No data
1099921601_1099921605 -9 Left 1099921601 12:88964511-88964533 CCTTCTTGCCCCTGGACACACAG No data
Right 1099921605 12:88964525-88964547 GACACACAGTTAAATAGAAGTGG No data
1099921601_1099921606 24 Left 1099921601 12:88964511-88964533 CCTTCTTGCCCCTGGACACACAG No data
Right 1099921606 12:88964558-88964580 TAGTCTTATTTATAATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099921601 Original CRISPR CTGTGTGTCCAGGGGCAAGA AGG (reversed) Intergenic
No off target data available for this crispr