ID: 1099925450

View in Genome Browser
Species Human (GRCh38)
Location 12:89011105-89011127
Sequence ACAAATTAGCAACAATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 614}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099925450 Original CRISPR ACAAATTAGCAACAATTGGG TGG Intergenic
900791888 1:4686237-4686259 ACAAATTACCACGAATTGAGTGG + Intronic
901902585 1:12378120-12378142 AGAAATTAGAAACAAATGGCGGG - Intronic
902059275 1:13628608-13628630 ACAAATGACCACAAATTGGGTGG - Intergenic
904842752 1:33383988-33384010 ACAAATTACCACAAACTGGGTGG - Intronic
906356566 1:45111463-45111485 ACAAATTACCACAAATTTGGTGG + Intronic
906670856 1:47653542-47653564 ACAAAATACCACAAATTGGGTGG + Intergenic
906732889 1:48098412-48098434 ACAAATTACCACAAACTGGGTGG - Intergenic
907237177 1:53060859-53060881 AGAACTTAGCAAGAATGGGGAGG - Intergenic
909538219 1:76761946-76761968 ACAAAATACCATAAATTGGGTGG - Intergenic
909567873 1:77076080-77076102 ACAAATTACCATAAACTGGGTGG + Intergenic
909696908 1:78477757-78477779 ACAAAGTACCACAAATTGGGTGG + Intronic
910040944 1:82851132-82851154 ACAAAATACCGTCAATTGGGTGG + Intergenic
910310984 1:85824371-85824393 ACAAATTACCACAAAATGGGTGG - Intronic
910438459 1:87228880-87228902 ACAAATTACCACCAACTTGGTGG - Intergenic
910514743 1:88047326-88047348 ACAAATTACCATAAACTGGGTGG - Intergenic
910864937 1:91779778-91779800 ACAAATTACCATAAACTGGGTGG + Intronic
910976458 1:92911439-92911461 ACAAAGTACCATAAATTGGGCGG - Intronic
911213997 1:95172168-95172190 ACAAAGTACCAAAAAGTGGGTGG - Intronic
911564816 1:99451469-99451491 ACATATTAACAAGAACTGGGAGG + Intergenic
911597224 1:99811389-99811411 ACAAAATACCAAAAAGTGGGTGG - Intergenic
911709576 1:101054497-101054519 ACAAATTACCACAAACTGGGTGG - Intergenic
912256319 1:108062080-108062102 ACAAATTACCAAAAATTTAGTGG - Intergenic
913135279 1:115882437-115882459 ACAAATAATCAAAAACTGGGTGG - Intergenic
913390689 1:118308151-118308173 ACAAATTACCACCAATTTAGTGG - Intergenic
913417611 1:118629079-118629101 AGACATTAGCAAAAATGGGGAGG + Intergenic
913575556 1:120170150-120170172 ACAAAATACCATAAATTGGGTGG - Intronic
914557866 1:148785792-148785814 ACAAAATACCATAAATTGGGTGG - Intergenic
914614968 1:149344438-149344460 ACAAAATACCATAAATTGGGTGG + Intergenic
916018790 1:160775335-160775357 GCAAATCAGCAGCAAGTGGGTGG + Intergenic
916116981 1:161493756-161493778 ACAAATTATCACAAACTGGGTGG - Intergenic
916503001 1:165402380-165402402 AAAAATTGGTAACAATTGGCCGG - Intronic
918007351 1:180554369-180554391 ACAAATTACCACAAATTTGGTGG - Intergenic
918171584 1:182003186-182003208 CCAAAAAAGCAACATTTGGGTGG + Intergenic
918745671 1:188195507-188195529 ACCAATTACCAAAAATTGAGAGG - Intergenic
918866017 1:189901363-189901385 ACAAATTCTGAACAATTGGAAGG + Intergenic
919364315 1:196637917-196637939 ACAAATTACCACTAACTGGGTGG - Intergenic
919542664 1:198870632-198870654 ACAAATTTGGAAAAATTTGGGGG + Intergenic
920218957 1:204381908-204381930 ACAAATTACTACAAATTGGGTGG - Intergenic
920774081 1:208918789-208918811 AGACATTAACAACAAGTGGGGGG + Intergenic
920831702 1:209471538-209471560 ACAAAATACCACCAACTGGGTGG + Intergenic
920862389 1:209721211-209721233 ACAAATTACCACAAACTGGGTGG - Intronic
920925043 1:210333245-210333267 ACAAATTAGCATTAAGAGGGAGG - Intronic
921537087 1:216364814-216364836 ACAAATTACCACCAACTGGATGG - Intronic
922020248 1:221697155-221697177 ACAAAGTACCACAAATTGGGTGG + Intergenic
922036090 1:221849969-221849991 ACAAAATACCATAAATTGGGTGG + Intergenic
922326515 1:224533474-224533496 ACAAATCACCACAAATTGGGTGG + Intronic
922332179 1:224587023-224587045 ACAAATTACCACTAACTGGGTGG - Intronic
922342988 1:224672410-224672432 ACAAATTACCACCAGGTGGGTGG + Intronic
923267182 1:232326228-232326250 ACAAAGTACCACCAACTGGGTGG + Intergenic
923587381 1:235286194-235286216 ACAAATTATCAAAAATTAGCTGG - Intronic
924402422 1:243700072-243700094 ACAAATTAATAAAAAGTGGGTGG - Intronic
1063053985 10:2483653-2483675 ACAAATTAGCACAAACTGGGGGG - Intergenic
1063068858 10:2638451-2638473 ACAAATTACCATAAACTGGGTGG - Intergenic
1063253699 10:4302989-4303011 GCAAATTACCACCAACTGGGTGG + Intergenic
1063715105 10:8519355-8519377 ACAAATTAGCACAAACTTGGTGG - Intergenic
1063834938 10:10001933-10001955 ACAAATAACCAACAACTAGGGGG + Intergenic
1064536384 10:16361577-16361599 ACAAATTAACAAAAACTGAGTGG - Intergenic
1064722890 10:18247641-18247663 ATGAAATAGCATCAATTGGGTGG + Intronic
1065048302 10:21764334-21764356 TCAAAATAACAACAATTGGTAGG + Intronic
1065441984 10:25762373-25762395 ACAAATTATCAAGGAGTGGGAGG - Intergenic
1065799748 10:29341329-29341351 AAAAATAAGAAACAATTGGATGG + Intergenic
1066416504 10:35226534-35226556 ACAAATTACCACCAATTTAGGGG - Intergenic
1067789088 10:49273989-49274011 ACAAATTAACACAAATTAGGTGG - Intergenic
1068196089 10:53718465-53718487 ACAAATTATCACAAATTGGGTGG + Intergenic
1068214026 10:53959029-53959051 ACAAAATACCATAAATTGGGTGG - Intronic
1068298901 10:55113147-55113169 ACAAAATACCAAAAATTGAGTGG - Intronic
1068567418 10:58591355-58591377 ACAAAATACCATCAACTGGGTGG + Intronic
1068939473 10:62666688-62666710 ACAAAGTACCACAAATTGGGTGG - Intronic
1069435224 10:68375476-68375498 AAAAATTAGAGACAATTGGCCGG + Intronic
1070049836 10:72877645-72877667 ACAAAATAGCAAAAATTGCTAGG + Intronic
1070084315 10:73220871-73220893 ACAAAATAGCACTGATTGGGTGG - Intronic
1070310570 10:75270655-75270677 ACAAATTGCCACAAATTGGGAGG + Intergenic
1072985170 10:100133118-100133140 ACAAAGTACCAAAAATTTGGTGG - Intergenic
1074432600 10:113406623-113406645 ACAAATTACCACAAATTAGGTGG - Intergenic
1074608474 10:114997933-114997955 TCAATTCAGCAACAATTAGGGGG + Intergenic
1074672214 10:115804617-115804639 ACAATTTAGCATAAACTGGGCGG - Intronic
1075191610 10:120314836-120314858 ACAAATTACCACAAACTGGGTGG + Intergenic
1075200232 10:120396175-120396197 ACAAATTACCAAAAACTAGGTGG - Intergenic
1076405585 10:130210419-130210441 ACAAAGTATCACAAATTGGGTGG + Intergenic
1077933506 11:6758463-6758485 ACAAATTACAACCAATTTGGTGG + Intergenic
1077988929 11:7384235-7384257 ACAAATTACCAACTCCTGGGAGG - Intronic
1078206407 11:9233847-9233869 ACAAATTACCACAAACTGGGTGG - Intronic
1078437293 11:11335959-11335981 ACAAATTACCATGAATTTGGTGG - Intronic
1079384839 11:19969644-19969666 AGAAATTAACAACAGTTGGCTGG + Intronic
1079669465 11:23149277-23149299 ACAAAGTAGCACAAACTGGGAGG + Intergenic
1080000834 11:27347046-27347068 ACAAAATACCACAAATTGGGTGG - Intronic
1080472323 11:32558444-32558466 ACAAATTACCACAAATTAGGTGG + Intergenic
1080563744 11:33489139-33489161 ACAAAATAGCAAAGACTGGGTGG + Intergenic
1081188724 11:40077624-40077646 ACAAATTACCACAAACTGGGTGG - Intergenic
1081520110 11:43873354-43873376 ACAAATTACCACAAATGGGGTGG + Intergenic
1082681885 11:56183988-56184010 ACAAATTACCATAAAATGGGTGG + Intergenic
1082924736 11:58532735-58532757 ACCAATTAGCAAGATGTGGGTGG + Intronic
1084105825 11:66979626-66979648 ACAAATTATCACAAACTGGGTGG + Intergenic
1084384341 11:68833288-68833310 AAAAATTAGCAATAATGGGAAGG + Intronic
1085077641 11:73605927-73605949 ACAAATTACCATAAACTGGGTGG - Intergenic
1085773931 11:79348758-79348780 ACAAAATACCATAAATTGGGTGG - Intronic
1085841681 11:80018515-80018537 ACAAAATATCACAAATTGGGTGG + Intergenic
1085879839 11:80453637-80453659 ACAAATTAGCACAAACTGGATGG + Intergenic
1086046046 11:82533361-82533383 ACTAATTTGCAAAAATTTGGAGG - Intergenic
1086453981 11:86943705-86943727 ACAAATTATCACAAACTGGGTGG + Intronic
1086662507 11:89437587-89437609 GCAAATTAGCACCATTTTGGTGG - Intronic
1087332421 11:96797763-96797785 ACAAATTACCACCGACTGGGTGG + Intergenic
1088166860 11:106949636-106949658 ACACATTAGCAGCTATTGTGTGG - Intronic
1088234325 11:107706254-107706276 ACATATTAGAATCACTTGGGGGG - Intergenic
1088247870 11:107836793-107836815 ACAAATTACCACCAATTTAGTGG - Intronic
1088278854 11:108116932-108116954 GCAAATTACCACCAACTGGGTGG - Intergenic
1088430766 11:109756290-109756312 ACAAATTAGCCTCAAATGGTAGG + Intergenic
1089157974 11:116416541-116416563 ACAAATTACCATAAACTGGGAGG - Intergenic
1090288324 11:125519489-125519511 CCAAAAAAGCAACATTTGGGTGG + Intergenic
1092305614 12:7297681-7297703 ACAAATTGGCAACCAGTGGAAGG - Intergenic
1093518472 12:20019549-20019571 ACAAATTACCACCAATTTAGTGG - Intergenic
1094768689 12:33627667-33627689 ACAAATTAGACACAATTGCTTGG + Intergenic
1095323724 12:40861953-40861975 ACAAATTAGGAAAAAGTGGGAGG + Intronic
1095401158 12:41815796-41815818 ACAAATGAGGGAAAATTGGGAGG - Intergenic
1095855442 12:46855149-46855171 CCAAATTAGGAAAAATGGGGGGG + Intergenic
1097347938 12:58515846-58515868 CCAAATTACCAACAATTTAGTGG + Intergenic
1097827065 12:64185126-64185148 ACAAAATACCAAAAATTGGATGG - Intergenic
1098260613 12:68666381-68666403 ACAAATTATCACAAATTTGGTGG + Exonic
1098414651 12:70219349-70219371 ACAAATTAATACAAATTGGGTGG + Intergenic
1098835320 12:75417450-75417472 ACAAATTACCACAAATTCGGTGG - Intronic
1099064245 12:77953886-77953908 ACAAATTACCACAAATTTGGTGG + Intronic
1099134644 12:78880915-78880937 ACAAATTAGCAATAGTTAGGAGG - Intronic
1099337261 12:81378235-81378257 ACAAATTGCCACCAACTGGGTGG - Intronic
1099674861 12:85745643-85745665 ACAAATTATCAAACATTAGGAGG + Intergenic
1099800044 12:87445208-87445230 ACAAATTACCTCCAACTGGGGGG - Intergenic
1099925450 12:89011105-89011127 ACAAATTAGCAACAATTGGGTGG + Intergenic
1100124533 12:91407566-91407588 ACAAATTAGCACAAATTCAGTGG - Intergenic
1100514050 12:95308618-95308640 ACATTTTAGCAAAAATTGGTTGG + Intergenic
1100944770 12:99769030-99769052 ACAAATTAGCGTAGATTGGGTGG - Intronic
1101191311 12:102336394-102336416 ACAAATTACCACAAACTGGGTGG - Intergenic
1101201131 12:102437291-102437313 ACATATTAGCACCACTTGTGTGG + Intronic
1101505326 12:105341038-105341060 ACAAATTACCACAAACTGGGTGG - Intronic
1101733101 12:107442848-107442870 ACAAAATAGCATAAACTGGGTGG + Intronic
1101852859 12:108418122-108418144 ACAAATTATCACCAACTGGGTGG + Intergenic
1101934018 12:109041260-109041282 ATAAATTAACAACAAATAGGAGG + Intronic
1102310170 12:111838483-111838505 ACAAAGTATCACAAATTGGGTGG - Intergenic
1102783207 12:115583465-115583487 ACAAATTACGAACAACTTGGTGG - Intergenic
1102935252 12:116891147-116891169 ACAAATTACCAACAACTGGGTGG - Intergenic
1103157321 12:118697098-118697120 ACAAATTACCACCAACTGGGTGG - Intergenic
1103945190 12:124522306-124522328 ACAAATTATTACAAATTGGGTGG + Intronic
1104081935 12:125436729-125436751 ACAAAGTACCACCAATTGAGTGG - Intronic
1105393778 13:20008425-20008447 AGAGATTAACAACAATTGGGCGG - Intronic
1105914809 13:24903598-24903620 ACAAAGTACCAGCAACTGGGTGG - Intronic
1106437970 13:29740463-29740485 ACAAAGTACCTCCAATTGGGTGG - Intergenic
1106470529 13:30050219-30050241 ACAAAGTACCACAAATTGGGTGG + Intergenic
1106630483 13:31467065-31467087 ACAAATTACCACAAAATGGGAGG - Intergenic
1107543350 13:41413801-41413823 ACAAATTAGCACTAATTTAGTGG + Intergenic
1107790786 13:44000056-44000078 ACAAATTACCACAAACTGGGTGG - Intergenic
1108098509 13:46930015-46930037 ACAAATTACCATAGATTGGGTGG - Intergenic
1108283996 13:48887508-48887530 ACAAAATATCATCAATTGGGTGG + Intergenic
1108870958 13:54985566-54985588 AAAGTTTAGCAAAAATTGGGGGG - Intergenic
1108984113 13:56561379-56561401 ACAAATTAGCCAAATTTGGAGGG - Intergenic
1109145894 13:58779415-58779437 AACAACAAGCAACAATTGGGAGG + Intergenic
1109264528 13:60182194-60182216 AAACATTAGCAAAAATTAGGAGG - Intergenic
1109458902 13:62627832-62627854 CTAAAATAGCAACATTTGGGTGG + Intergenic
1110561098 13:76911390-76911412 ACAAAATAGCATGAACTGGGTGG + Intergenic
1110618032 13:77563126-77563148 ACAGATGAGCAAAAATGGGGGGG - Intronic
1111338954 13:86858578-86858600 AGAAAGTATCAACAATTTGGGGG + Intergenic
1111930109 13:94503784-94503806 ACAAATTACCATAAATTGAGTGG - Intergenic
1112984459 13:105430376-105430398 ACAATTTACCAACAAGTGGCCGG - Intergenic
1113261821 13:108573199-108573221 AGAAACCAGCAACAAGTGGGAGG + Intergenic
1114169215 14:20254739-20254761 ACAAATTACCACCAATTTAGTGG + Intergenic
1114446165 14:22789996-22790018 ACAAGTTACCACCAATTGAGTGG - Intronic
1114690083 14:24573476-24573498 ACAAAATAGCACAAATTGGGTGG - Intergenic
1115022321 14:28697321-28697343 ACAAATTACCACAAATTTGGTGG - Intergenic
1116075252 14:40102493-40102515 ACAAATTACCACAAATTTGGTGG - Intergenic
1116469359 14:45269202-45269224 AAAAATTAGCAGCTATTGGGAGG - Intergenic
1116573037 14:46542850-46542872 ACAAATTAGCTTAAATTGGGTGG + Intergenic
1116739715 14:48739076-48739098 ACAAATTACCAGAAATTTGGTGG + Intergenic
1116891888 14:50276765-50276787 ACAAAATAGCACAAACTGGGTGG - Intronic
1116987019 14:51231338-51231360 ACAAAGTACCAAAAACTGGGTGG + Intergenic
1117379269 14:55144293-55144315 AAAAATTAGCCACACGTGGGTGG - Intronic
1117475939 14:56095187-56095209 ACAAATTATCACAAACTGGGTGG + Intergenic
1117524636 14:56585732-56585754 AAAAATTAGCAACAGTTAGAAGG - Intronic
1117915560 14:60674659-60674681 ACAAATCACCATAAATTGGGTGG - Intergenic
1118087411 14:62433598-62433620 ACAAATTATCACAAACTGGGTGG + Intergenic
1118869222 14:69727345-69727367 ACAAATTACCACTAACTGGGTGG + Intronic
1118987506 14:70769502-70769524 ACAAATTAACAGAAACTGGGTGG + Intronic
1119140603 14:72263814-72263836 ACAAAATACCACCAACTGGGTGG - Intronic
1119846793 14:77836542-77836564 ACAAATTACCACAAATTGGGTGG + Intronic
1119895547 14:78216676-78216698 ACAAAGTACCAGCAACTGGGTGG + Intergenic
1120081669 14:80224656-80224678 ACAGATTATCAAAAATTGGTTGG - Intronic
1120208137 14:81608181-81608203 ACAAATTACCACAAATTGGGTGG + Intergenic
1120421495 14:84292108-84292130 ACAAATTACCACTAACTGGGTGG + Intergenic
1120715008 14:87831383-87831405 ACAAATTATCAAAAATTGTGTGG + Intergenic
1121256043 14:92531131-92531153 ACAAAATAGCACCGATGGGGTGG + Intronic
1121694189 14:95899534-95899556 ACAAAATAGCATAAATTGAGTGG + Intergenic
1121926862 14:97934913-97934935 ATAAATTATCACCAACTGGGTGG - Intronic
1121944051 14:98102299-98102321 ACAAATTATCACAAACTGGGTGG + Intergenic
1121950385 14:98166472-98166494 ACAAATTTGAAGAAATTGGGTGG - Intergenic
1122222743 14:100251476-100251498 ACAAACTACCACCAATTTGGTGG - Intronic
1122236857 14:100335679-100335701 AAAAATTAGCAAGATTTGGCTGG - Intronic
1123788353 15:23694714-23694736 ACACATTAGTAATAACTGGGGGG - Intergenic
1124226461 15:27899286-27899308 ACAAATTAACAGAAATTGAGTGG - Intronic
1125159758 15:36629185-36629207 ACAAATTACCAAAAACTTGGTGG - Intronic
1125915825 15:43486388-43486410 ACAAATAAACAAAAATTGGGAGG + Intronic
1126681088 15:51202818-51202840 ACAAATTACCACAAACTGGGTGG - Intergenic
1127241071 15:57114702-57114724 TGAAATTAGAAACAATTGAGAGG - Intronic
1127848662 15:62894257-62894279 ACAAATTACCATAAACTGGGTGG + Intergenic
1129176932 15:73847109-73847131 ACAAATTACCACAAATTTGGTGG - Intergenic
1130429286 15:83830640-83830662 ACAAATTACCACAAATTTGGTGG + Intronic
1130660542 15:85828514-85828536 ACAAATTACCACAAACTGGGTGG + Intergenic
1130716543 15:86340668-86340690 ACAAATTACCACCAATTAGTTGG - Intronic
1130921733 15:88351856-88351878 ACAAATTAGCATAGAATGGGTGG - Intergenic
1131369168 15:91865455-91865477 ACAAATTACCACAAACTGGGTGG + Intronic
1131437634 15:92435862-92435884 ACAAATTACCAACAACGCGGCGG + Intronic
1133434795 16:5769857-5769879 ACAAAGTACCACAAATTGGGTGG - Intergenic
1133701612 16:8314586-8314608 ACAAATTATCACAAACTGGGTGG + Intergenic
1133832092 16:9332773-9332795 ACAAATTACCACAAATGGGGTGG + Intergenic
1133899923 16:9964440-9964462 ACAAATTACCATCAACTTGGCGG + Intronic
1133921968 16:10161633-10161655 ACAAATTACCACCAATTTAGTGG + Intronic
1134436133 16:14259282-14259304 AAAAATTAGCAAAAATTAGCCGG + Intronic
1135130190 16:19847309-19847331 ATAAAATAGGAACAATGGGGAGG - Intronic
1135410028 16:22226741-22226763 AAAAATTAACAACAAGTGGCTGG - Intronic
1135511195 16:23084981-23085003 ACAAATAAGCTGCAATTAGGGGG + Exonic
1136265253 16:29113256-29113278 ACAAATTACCATCAATGGGATGG + Intergenic
1138825008 16:60308570-60308592 ACAAATTTCCATAAATTGGGTGG + Intergenic
1140207047 16:72941768-72941790 AGAAACTAGCAACATTAGGGTGG - Intronic
1140942027 16:79730858-79730880 ACAAATTATCACAAATTGGGTGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143207041 17:5150454-5150476 ACAAATTACCATAAATTTGGTGG + Intronic
1144009094 17:11128346-11128368 ACAAAATAGCACAAAGTGGGTGG + Intergenic
1144369763 17:14578859-14578881 AAAAATTAGCAAAACTTGGCTGG - Intergenic
1145054997 17:19696708-19696730 ACAAAGTACCAAAAATTGGATGG - Intronic
1145275996 17:21430849-21430871 ACAAATTAGCACAAACTTGGTGG - Intergenic
1145313840 17:21716762-21716784 ACAAATTAGCACAAACTTGGTGG - Intergenic
1146520891 17:33524723-33524745 ACAAATAAATAACACTTGGGAGG - Intronic
1147035721 17:37678912-37678934 ACAAATTACCAAAAATGTGGTGG - Intergenic
1147583864 17:41641551-41641573 ACAAATTATCAAAAACTTGGGGG - Intergenic
1148941153 17:51212876-51212898 AAAAATTAGCTAGACTTGGGAGG - Intronic
1149013740 17:51884668-51884690 ACAAATTAGCACAAACTGGGAGG + Intronic
1149333284 17:55608466-55608488 AGAAAATATCACCAATTGGGTGG + Intergenic
1149772118 17:59330847-59330869 GAAAATTAGCAGCAATGGGGCGG + Intergenic
1149873306 17:60203445-60203467 ACAAATTACCACAAATTTGGTGG - Intronic
1150044115 17:61894553-61894575 ACAAAAAAGCAACAACTGGCCGG + Intronic
1150087088 17:62280695-62280717 ACAAATTACCATAAATTTGGTGG - Intronic
1150375657 17:64679398-64679420 ACAAAGTACCACAAATTGGGTGG - Intergenic
1150721457 17:67617562-67617584 ACAAATCATCACAAATTGGGTGG + Intronic
1150853075 17:68724189-68724211 ACAACTTAGCAATATTTGTGCGG - Intergenic
1150915017 17:69428177-69428199 ACAAAGTACCACAAATTGGGTGG + Intronic
1151103016 17:71577283-71577305 ATAAATTATCACCAACTGGGTGG - Intergenic
1151232674 17:72695963-72695985 ACAAATTACCACAAACTGGGTGG - Intronic
1151307248 17:73271099-73271121 ACAAATTACCACAAATTGGCCGG - Intergenic
1151400961 17:73855776-73855798 ACAAATTACCAGAAACTGGGAGG - Intergenic
1151529277 17:74694293-74694315 ACAAATTAGCACCAATTTCGTGG + Intronic
1153933873 18:9903186-9903208 ACAAATTATCACAAACTGGGTGG - Intergenic
1154272283 18:12930706-12930728 ACAAAATACCACAAATTGGGTGG + Intergenic
1155222150 18:23695251-23695273 ACAAAGTAGCACAAAATGGGTGG - Intronic
1155684520 18:28532332-28532354 ACAAATTACCACCAACTTGGTGG - Intergenic
1156306552 18:35883359-35883381 ACAAATTACCACTAACTGGGTGG + Intergenic
1157912889 18:51635900-51635922 TCAAATTAGGAAAAATTGAGGGG - Intergenic
1158091115 18:53714820-53714842 ACAAAATATCAAGACTTGGGTGG + Intergenic
1158218986 18:55130181-55130203 ACAAAGTATCAAAAACTGGGTGG - Intergenic
1158399219 18:57105696-57105718 ACAAAATATCATAAATTGGGTGG + Intergenic
1158421091 18:57294968-57294990 ACAGATTAACAACAGTAGGGAGG + Intergenic
1158625711 18:59069941-59069963 ACAAAGTACCAAAAACTGGGTGG - Intergenic
1158910600 18:62057464-62057486 TCAAAATAGCAACAAGTGGCTGG - Intronic
1159434164 18:68394576-68394598 ACCAATTAGCACAAATTTGGTGG + Intergenic
1159525794 18:69587156-69587178 ACAAATTACCAAAAACTTGGTGG + Intronic
1159533342 18:69683747-69683769 ACAAAGTACCAACAATTGGTTGG - Intronic
1160328843 18:77974089-77974111 ACAAATTACCAAAAAATGGATGG + Intergenic
1160489079 18:79321689-79321711 ACAAATTAAAAACAATTGGATGG + Intronic
1162444558 19:10714302-10714324 ACAAAATACCATCAACTGGGTGG + Intergenic
1163106731 19:15127547-15127569 ACACATTACCACAAATTGGGTGG + Intergenic
1164353891 19:27392529-27392551 ACAAATCAGCAGGAAGTGGGTGG - Intergenic
1167238902 19:48331592-48331614 ACACGTTAGCAAAAATTAGGAGG + Intergenic
926394163 2:12424197-12424219 ACAAAATACCACAAATTGGGTGG + Intergenic
926507025 2:13729572-13729594 ACAAAATATCATAAATTGGGTGG + Intergenic
926820965 2:16851421-16851443 ACAAATTACCATTAACTGGGTGG - Intergenic
926916662 2:17898838-17898860 TCAAATTAGCATCAAATAGGTGG + Intronic
927023298 2:19040170-19040192 ACAAATTACCACAAATTTGGTGG + Intergenic
927654357 2:24932902-24932924 ACAAATTACCACAAACTGGGTGG + Intergenic
927897994 2:26797685-26797707 ACAAATTAGCAACAACTCAGTGG - Intronic
928138487 2:28707069-28707091 ACAAATTAGCACAAACTGGGTGG - Intergenic
928251565 2:29685720-29685742 ACAAATTACCAGAAAGTGGGGGG + Intronic
928254809 2:29712942-29712964 ACAAAGTACCATCAACTGGGTGG + Intronic
928448623 2:31356705-31356727 ACAAATCACCACAAATTGGGTGG - Intronic
928465303 2:31517851-31517873 ACAAATTATCAATAGTTGAGTGG - Intergenic
928650671 2:33400504-33400526 ACAAAGTACCAAAAACTGGGCGG - Intergenic
928832486 2:35504398-35504420 ACAAATTACCATAAACTGGGTGG + Intergenic
929243636 2:39678038-39678060 ACAGATGAGCAACTATTTGGTGG + Intronic
929373066 2:41250261-41250283 ACAAATTACCACTAATTAGGTGG + Intergenic
929681881 2:43999910-43999932 GAAAATTAGCAATAATTGGCTGG - Intergenic
930084753 2:47488293-47488315 ACAATTTGGCAACATTTGGCTGG + Intronic
930509168 2:52323445-52323467 ACAAATTACCACAAATTTGGTGG - Intergenic
931451553 2:62371226-62371248 ACAAATTACCAAAAATTTGGTGG - Intergenic
931918171 2:66982300-66982322 ACAAATTACCATAAATTTGGTGG + Intergenic
932016920 2:68037970-68037992 ACAAAGTATCAATAACTGGGTGG + Intergenic
932848248 2:75156731-75156753 ACAAATTACCACAAACTGGGTGG - Intronic
932981367 2:76672344-76672366 ACAAATTACCACAAACTGGGTGG + Intergenic
933463016 2:82613232-82613254 ACAAATTAGCAAATATAGGAGGG - Intergenic
933510009 2:83228796-83228818 ACTGATTAGCAAAAATTAGGAGG - Intergenic
933541134 2:83644056-83644078 ACAAATTACCACAAACTGGGAGG + Intergenic
935346516 2:102113093-102113115 ACAAATTATCATAGATTGGGTGG - Intronic
935515334 2:104029537-104029559 ACAAAATATTAAAAATTGGGTGG + Intergenic
936096939 2:109537614-109537636 ACAAATTACCATAAATTTGGTGG + Intergenic
936602776 2:113915159-113915181 ACACAGTACCAAAAATTGGGTGG + Intronic
937017358 2:118618423-118618445 ACTAATCCGCAACAATTGTGTGG - Intergenic
937760366 2:125593415-125593437 ACAAATTACCACAAATTTGGTGG - Intergenic
938877449 2:135547131-135547153 ACAAATTATAAACATTTTGGTGG + Intronic
939135029 2:138283424-138283446 ACAAACTAGCAAATATTGGCAGG + Intergenic
940259075 2:151761715-151761737 ACAAAGTACCACCAACTGGGTGG - Intergenic
940275235 2:151933085-151933107 ACAAAGTACCACCAACTGGGTGG - Intronic
940956024 2:159728549-159728571 ACAGATGACCAAGAATTGGGTGG + Intronic
941097256 2:161252706-161252728 AAAAATTAGCAATTATTGGCCGG - Intergenic
941307239 2:163885430-163885452 ACAAAGTACCAAAAACTGGGTGG + Intergenic
942008719 2:171736980-171737002 ACAAATTACCACAAACTGGGTGG + Intronic
942280394 2:174357147-174357169 ACAAATGAATAACAATAGGGAGG - Intronic
942398829 2:175580148-175580170 ACAAATTACCAAGAAATGGGTGG + Intergenic
942434176 2:175953318-175953340 ACAGATTAGAAATAATTGGGAGG - Intronic
943019061 2:182551157-182551179 AAATAATAGCTACAATTGGGGGG + Intergenic
943380536 2:187139610-187139632 ACAAATTATCACCAACTGAGTGG + Intergenic
943775478 2:191761223-191761245 ACAAATTATCACCAATTTAGTGG - Intergenic
944175225 2:196821313-196821335 ACAAATTACCAAAAACTGGATGG - Intergenic
944529352 2:200652066-200652088 ACAAAATAGGAACAAATGGCAGG + Intronic
945188786 2:207166046-207166068 ACAAACTAGCAAGGATGGGGTGG - Intronic
945673162 2:212826376-212826398 ATAAATTACCACAAATTGGGTGG - Intergenic
946319013 2:218937925-218937947 ACAAACTAGCATAAATTGGGTGG - Intergenic
946867520 2:224055774-224055796 ACAAATTACCACAAACTGGGTGG + Intergenic
947364287 2:229378272-229378294 ACAAATTACCACAAATTGAGTGG - Intronic
947457761 2:230271172-230271194 ACAAATTACCACCAATTTAGTGG - Intronic
947599068 2:231434043-231434065 TCAAATTATGATCAATTGGGTGG - Intergenic
947796345 2:232896448-232896470 ACAAATTACCAGAAACTGGGTGG - Intronic
1169395502 20:5225346-5225368 ACAAAGTACCACAAATTGGGTGG - Intergenic
1169432378 20:5549607-5549629 ACATCTTAGCAACATTTGGATGG - Intronic
1169832098 20:9836633-9836655 ACAAGTTACCAAAAACTGGGTGG - Intronic
1169881163 20:10348957-10348979 ACAAATTACCAAAAACTTGGTGG + Intergenic
1170008268 20:11692769-11692791 ACAAATTAGCAGAAACTAGGTGG + Intergenic
1170165173 20:13354525-13354547 ACAAATTACAAATAATTGTGAGG + Intergenic
1170467471 20:16635925-16635947 ACAAATTACCACAAACTGGGTGG - Intergenic
1170482502 20:16780517-16780539 ATAAAATAGCAACAGTAGGGAGG + Intergenic
1171071321 20:22071061-22071083 ACAACTTGGCAACAAGGGGGTGG - Intergenic
1171145241 20:22775630-22775652 AGAAATAAGAAACAAATGGGAGG + Intergenic
1172400969 20:34651008-34651030 AAAAATTACCAACCATTGGCTGG - Intronic
1172582377 20:36058496-36058518 ACAAAATACCATCAATTGAGTGG + Intergenic
1173428803 20:42967612-42967634 ACAAATTACCATCCATTTGGTGG - Intronic
1173749124 20:45462605-45462627 ACAAAATACCACCAACTGGGTGG - Intergenic
1174086026 20:48007828-48007850 ACAAATTACCAAAGACTGGGTGG + Intergenic
1174435792 20:50505884-50505906 ACAAATTACCACAAATTTGGTGG - Intergenic
1174505696 20:51016103-51016125 ACAAATTACCACAAACTGGGTGG - Intronic
1174634602 20:51988153-51988175 ACAAATTACCATAGATTGGGTGG - Intergenic
1174814082 20:53671632-53671654 ACAAATTACCATAGATTGGGTGG - Intergenic
1175010022 20:55725622-55725644 ACAAATTACCAAAAACTTGGTGG + Intergenic
1175067858 20:56305292-56305314 ACAACTTGGTAATAATTGGGAGG + Intergenic
1175378224 20:58544004-58544026 AGAAATTAGGCATAATTGGGCGG + Intergenic
1176520993 21:7824146-7824168 ACAAATTAGGATCATTTGGGAGG - Intronic
1176878202 21:14156594-14156616 ACAAATTACCACAAATTTGGTGG - Intronic
1177208961 21:18046039-18046061 ACAAATTACCACCAGTTGGGTGG - Intronic
1177388833 21:20441025-20441047 ACAAATTATCACAAACTGGGTGG - Intergenic
1177550681 21:22618168-22618190 ACAGAGTAGCACAAATTGGGTGG + Intergenic
1177916954 21:27100822-27100844 ATAAAGTAGCACAAATTGGGTGG + Intergenic
1177943914 21:27444052-27444074 ACAAAGTATCAAAAACTGGGTGG - Intergenic
1178325510 21:31642265-31642287 ACAAATTACCACAAATTGGGTGG - Intergenic
1178347660 21:31845463-31845485 ACAAATTACCATCAACTGAGTGG - Intergenic
1178454083 21:32730573-32730595 ACAAATTACCATGAACTGGGTGG - Intergenic
1178655014 21:34454158-34454180 ACAAATTAGGATCATTTGGGAGG - Intergenic
1178818182 21:35950652-35950674 ACAAATTAGCACAAACTGAGTGG + Intronic
1178898325 21:36578955-36578977 ACAAAGTACCACCAACTGGGTGG + Intergenic
1179430897 21:41320431-41320453 ACAAATTAACACCAACTGGGTGG - Intronic
1179770707 21:43613484-43613506 ACAAATTATCACCAACTTGGTGG - Intronic
1182267182 22:29126278-29126300 ACAGATTATCACCAACTGGGTGG + Intronic
1185025029 22:48403921-48403943 AAAAGTTAGCAACAATGAGGAGG - Intergenic
950320083 3:12043364-12043386 ACAAATTACCACTAATTTGGTGG - Intronic
950370362 3:12524301-12524323 AGAAATTACCACAAATTGGGTGG + Intronic
950587165 3:13902029-13902051 ACAGATAAGCACAAATTGGGTGG + Intergenic
950602118 3:14044140-14044162 ACGGATTAGGAACAATAGGGTGG + Intronic
950816066 3:15703649-15703671 ACAAAATACCAAAAACTGGGTGG - Intronic
951066700 3:18275319-18275341 ACAAAGTACCACAAATTGGGTGG - Intronic
951427385 3:22563508-22563530 ACAATTTACCAACAATTTGGTGG - Intergenic
952070606 3:29630513-29630535 AAAAATTAGTAAGAATTGGAAGG + Intronic
952108963 3:30100432-30100454 ACAAAGTACCAAAAACTGGGTGG - Intergenic
952621374 3:35347211-35347233 ACAAATTACCATAAACTGGGTGG + Intergenic
952659410 3:35826931-35826953 ACAAATTACCACCAACTTGGTGG - Intergenic
953334089 3:42079165-42079187 ACAAATTACCACAAATTGAGTGG - Intronic
953814740 3:46145680-46145702 ACAAATTAACAAAAATTTAGTGG + Intergenic
955163809 3:56490730-56490752 ACAAAATACCAAAGATTGGGTGG - Intergenic
955533254 3:59896928-59896950 ACATGTTAGCAACGATTGGGAGG + Intronic
956513654 3:70022231-70022253 TCAAATTAGGTACATTTGGGGGG - Intergenic
957223978 3:77418955-77418977 AAAAATTAGCATAAATTGGGTGG + Intronic
957351250 3:79024268-79024290 ACATATTAGCAACAATGGGTCGG + Intronic
957368078 3:79252577-79252599 ACAAATTACCACAAACTGGGTGG - Intronic
957432037 3:80123464-80123486 ACAAAATACCACCAACTGGGTGG + Intergenic
957459067 3:80494142-80494164 ACAAATTATCACACATTGGGTGG + Intergenic
957782155 3:84833715-84833737 ACAAAATACCATCTATTGGGTGG + Intergenic
958536143 3:95407370-95407392 CCAAATTAGGGACAATTAGGAGG - Intergenic
958778750 3:98516570-98516592 AAAAATTAAAAACAATTGAGAGG + Exonic
958795396 3:98701759-98701781 ACAAATTATCACCAATTTAGTGG - Intergenic
959274210 3:104257005-104257027 ACAAATTAGCACAAACTTGGTGG - Intergenic
959375484 3:105584100-105584122 CCAAAAAAGCAACATTTGGGTGG - Intergenic
959916168 3:111818944-111818966 ACAAAATGTCATCAATTGGGTGG + Intronic
960017276 3:112906066-112906088 ACAAAATAGCAACAATTGTTTGG + Intergenic
960486732 3:118261513-118261535 AAAAATTAGCAAAGACTGGGTGG - Intergenic
960512571 3:118568629-118568651 AAAAATTACCAACAAATGGCTGG - Intergenic
961575028 3:127828274-127828296 AAAAATTAGCCAGACTTGGGAGG - Intergenic
962301256 3:134245070-134245092 ACAAAGTACCATAAATTGGGTGG - Intronic
962608989 3:137057174-137057196 ACAAAGTACCAAAAACTGGGTGG - Intergenic
962930029 3:140027545-140027567 ACAAATTACCACAAACTGGGAGG - Intronic
963891218 3:150637907-150637929 ACAAAATACCACCGATTGGGTGG + Intergenic
964485479 3:157181296-157181318 ACAAAGTACCAAAAACTGGGTGG + Intergenic
964541459 3:157784003-157784025 ACAAATTACCACAAATTTGGTGG + Intergenic
964925134 3:161946658-161946680 ACAAATTACCACCAATTTGGTGG - Intergenic
965056615 3:163725260-163725282 ACAAATTAGTACAAATTTGGTGG + Intergenic
965130385 3:164691986-164692008 ACAAATTAGCACAAACTTGGTGG + Intergenic
965166852 3:165204951-165204973 ACAAATTACCAAAAATTTAGTGG - Intergenic
965839053 3:172882228-172882250 ACAAATTATCATAAACTGGGTGG - Intergenic
965845681 3:172958603-172958625 ACAAAGTACCACCAACTGGGTGG + Intronic
967431890 3:189395255-189395277 AGAAATTAGCAAACATTTGGAGG - Intergenic
967617450 3:191588476-191588498 ACAATTTAGCATCTTTTGGGAGG - Intergenic
967726047 3:192863312-192863334 ACAAATCACCACAAATTGGGTGG - Intronic
967841564 3:194009004-194009026 ACAAATTACCACAAATTGAGTGG - Intergenic
969097804 4:4747147-4747169 ACAAAATATCACCAACTGGGTGG + Intergenic
969421289 4:7098000-7098022 ACAAAGTACCACCAACTGGGTGG - Intergenic
970112845 4:12658043-12658065 ACAAATTATCACAAATTGGGTGG - Intergenic
970189617 4:13501305-13501327 ACAAATTACCACAAATTGAGTGG + Intergenic
970246629 4:14071141-14071163 ACAAAGTAGCACAGATTGGGTGG - Intergenic
970867658 4:20777657-20777679 ACAAATTACCATAAACTGGGTGG - Intronic
970907335 4:21231027-21231049 ACAAATTCCCAGAAATTGGGTGG - Intronic
970974352 4:22025775-22025797 ACAAATTACCAAAAACTTGGTGG - Intergenic
971379759 4:26085949-26085971 ACAAATTATCACCTACTGGGTGG - Intergenic
971575296 4:28265129-28265151 ACAAATTACCAAAAACTTGGCGG + Intergenic
971797948 4:31253198-31253220 ACAAATTATCACAAACTGGGTGG + Intergenic
972180637 4:36460650-36460672 ATAAATTATAAACAATTAGGTGG - Intergenic
972413979 4:38820775-38820797 ACAAATTACCACAAACTGGGTGG - Intronic
972696270 4:41449771-41449793 ACAAACTACCACCAAGTGGGTGG + Intronic
972856298 4:43111430-43111452 ACAAAATACCACAAATTGGGTGG - Intergenic
973879008 4:55249950-55249972 ACAAATTACCACAAACTGGGGGG - Intergenic
974478039 4:62407959-62407981 ACAAATTACCACAAATTTGGTGG - Intergenic
974535492 4:63168508-63168530 ACAAATTACCACAAATTTGGTGG - Intergenic
975286381 4:72626145-72626167 ACAAATTACCACGAATTTGGTGG - Intergenic
976660162 4:87532514-87532536 ACAAAATACCACAAATTGGGTGG + Intergenic
976793346 4:88905283-88905305 AAAAATTAGCCAGGATTGGGTGG - Intronic
976999616 4:91481211-91481233 ACAAAGTACCACAAATTGGGTGG + Intronic
977405044 4:96587211-96587233 ATGCATTAGCAACAATTGAGAGG + Intergenic
977469260 4:97421590-97421612 ACAAAGTACCACAAATTGGGTGG + Intronic
977503655 4:97874965-97874987 ACAAATTACCTTCAATTGGGTGG - Intronic
977658123 4:99547378-99547400 ACAAATTACCACAAACTGGGTGG - Exonic
978050328 4:104190967-104190989 ACAAACTACCACAAATTGGGTGG + Intergenic
978171218 4:105672606-105672628 ACAAATTACCACAAATTTGGTGG + Intronic
978204471 4:106063918-106063940 ACAAAATACCAAAGATTGGGTGG - Intronic
978256377 4:106697321-106697343 ACAAAGTATCACCAACTGGGTGG + Intergenic
978920083 4:114173600-114173622 ACAAAATACCTAAAATTGGGTGG - Intergenic
979672611 4:123376728-123376750 ACAAATTAACACAAATTTGGTGG + Intergenic
979925581 4:126558949-126558971 ACAAATTACCATAAACTGGGTGG - Intergenic
980080169 4:128335640-128335662 AAAAATTAGCCACTAATGGGAGG + Intergenic
980703673 4:136463768-136463790 ACAAAGTAGCAAAACTTTGGGGG - Intergenic
980845959 4:138325384-138325406 ACAAAGTAGCACAAACTGGGTGG + Intergenic
981145716 4:141321721-141321743 ATAAAGTACCAACAACTGGGTGG + Intergenic
981505047 4:145490450-145490472 TCAAATTCTAAACAATTGGGGGG + Intronic
981956850 4:150485754-150485776 ACAAAGTACCACAAATTGGGTGG - Intronic
982217048 4:153091559-153091581 ACAAATTACCACAAATTTGGTGG + Intergenic
982348301 4:154385811-154385833 ACAAATTACCAAGAATTTGGTGG - Intronic
983682735 4:170372228-170372250 ACAAACTGGCAAAAATTAGGTGG - Intergenic
984620474 4:181946486-181946508 ACAAATTAGCAGTAATTCAGAGG - Intergenic
985360068 4:189164974-189164996 ACAAGTTAGAAACAAGTTGGAGG + Intergenic
985968051 5:3352664-3352686 ACAAATTACCAACAATCAAGTGG + Intergenic
986023324 5:3825260-3825282 ACAAATTATCACCAACTTGGTGG - Intergenic
986048250 5:4061968-4061990 ACAAAATACCATCAATTGGGTGG - Intergenic
986316539 5:6592575-6592597 ACAAATTTGCATCAATTGCCGGG + Intergenic
986414481 5:7514949-7514971 ACAAATTATCACAAAGTGGGTGG - Intronic
986584568 5:9300983-9301005 ACAAATTACCACAAATTTGGTGG - Intronic
987102915 5:14608238-14608260 ACAAAATACCATAAATTGGGTGG + Intronic
987498577 5:18675523-18675545 ACAAATTACCAAAAACTGGGTGG + Intergenic
987549562 5:19361071-19361093 ACAAAGTACCACAAATTGGGTGG + Intergenic
987984422 5:25127638-25127660 CCAAATTAAGAACATTTGGGGGG + Intergenic
988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG + Intronic
989001158 5:36762292-36762314 ACAAAGTACCATCAACTGGGTGG + Intergenic
989277212 5:39603090-39603112 ACAAATTACCACAAACTGGGTGG + Intergenic
989344667 5:40416551-40416573 ACACATTATCACCAACTGGGTGG - Intergenic
990120255 5:52442497-52442519 ACAAAATACCATCAACTGGGTGG - Intergenic
990288887 5:54328805-54328827 ACAAATTACCACAAACTGGGTGG + Intergenic
990370616 5:55114558-55114580 ACAAATTACCACCCATTGGGTGG + Intronic
990604341 5:57394020-57394042 ACAAATTACCACAAACTGGGTGG - Intergenic
990686637 5:58310241-58310263 ACAAATTACCACCAACTTGGTGG + Intergenic
990721549 5:58701535-58701557 ACAAATTACCAAAAATTTAGTGG + Intronic
991277145 5:64862743-64862765 ACAAAATACCATCAACTGGGTGG + Intronic
991336226 5:65550347-65550369 AAAACTTAGAAACAATTGGAGGG + Intronic
991500772 5:67274450-67274472 ACAAATTACCACAAATTTGGTGG + Intergenic
991916698 5:71612710-71612732 ACAAATTATCACAAATTGAGTGG + Intronic
991939981 5:71841372-71841394 ACAAAGTAGCACAAACTGGGTGG - Intergenic
991971231 5:72143651-72143673 ACAAAGTATCATCAACTGGGTGG + Intronic
991993276 5:72362457-72362479 ACAAAATACCAAAAACTGGGTGG - Intergenic
992183839 5:74224638-74224660 ACAAATTAACACAAATTTGGTGG - Intergenic
992348575 5:75906273-75906295 ACAAATTATCACCAATCGAGTGG - Intergenic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
992923772 5:81558271-81558293 ACAAATTAACAAAAACTGGGTGG + Intronic
993018295 5:82562214-82562236 ACAAATTACCACAAATTTGGTGG + Intergenic
993300172 5:86198974-86198996 ACAAATTATCACAGATTGGGTGG + Intergenic
993676881 5:90826294-90826316 AAAATCTAGCAATAATTGGGTGG - Intronic
994251802 5:97544417-97544439 ACAAAGTACCAAAGATTGGGTGG - Intergenic
994550286 5:101225869-101225891 ACAAATTAGCACCAGCTGGGTGG - Intergenic
994931914 5:106199708-106199730 ACAAATTACCACAAATTGGGAGG - Intergenic
995470858 5:112500783-112500805 ACAAACTACCATCAATTTGGTGG + Intergenic
996572883 5:124951456-124951478 ACAAATTAGCACCAACTTGGTGG - Intergenic
997172734 5:131739923-131739945 AAAAATTAGCAATGATTGGTTGG - Intronic
998454272 5:142258868-142258890 ACAAATTAGCATAAACTGAGTGG - Intergenic
999487711 5:152015747-152015769 ACAAAGTACCACAAATTGGGTGG - Intergenic
1000662817 5:163956832-163956854 ACAAAATAGCACAGATTGGGTGG - Intergenic
1000821949 5:165995704-165995726 ACAAATTATCACAAACTGGGTGG - Intergenic
1001244974 5:170099096-170099118 ACAAATTACCACTAATTGAGTGG + Intergenic
1001657503 5:173363327-173363349 ACACATTACCACAAATTGGGTGG - Intergenic
1001741944 5:174060544-174060566 ACAAATTACCAAAAATTAAGTGG + Intronic
1003306254 6:4932177-4932199 ACAAAATACCATCAACTGGGTGG + Intronic
1003928480 6:10900141-10900163 ACAAAATGCCATCAATTGGGAGG + Intronic
1004010020 6:11675703-11675725 ACAAATTATCACAAACTGGGTGG + Intergenic
1004194909 6:13494497-13494519 ACAAATTAGCCACAAAGGCGTGG + Intergenic
1004260703 6:14105114-14105136 TCCCATTAGCAACAATTGGTGGG + Intergenic
1004308769 6:14525062-14525084 ACAAAGTACCATGAATTGGGTGG + Intergenic
1004315232 6:14581082-14581104 ACAAAGTACCACAAATTGGGTGG - Intergenic
1004452489 6:15759570-15759592 ACAAATTATCACAAACTGGGAGG - Intergenic
1004697297 6:18045640-18045662 ACAAATTACCTCAAATTGGGGGG - Intergenic
1005054760 6:21719186-21719208 ACAAAGTAGCACAAATTTGGTGG + Intergenic
1005447305 6:25937877-25937899 ACAAATTAGCAAAAACTTAGTGG - Intergenic
1005709087 6:28486298-28486320 ACAAATTACCACAAACTGGGTGG + Intergenic
1006692522 6:35901527-35901549 ACAAAGTACCAAAAACTGGGTGG - Intronic
1007405452 6:41633367-41633389 ACAAAGTATCAAAAACTGGGTGG - Intergenic
1007586410 6:42992838-42992860 ACAAATTATTACAAATTGGGTGG + Intronic
1007985068 6:46199155-46199177 ACAAATTACCACCAACTTGGCGG - Intergenic
1008103111 6:47413881-47413903 TACAATTAGCAACAGTTGGGAGG + Intergenic
1008871908 6:56282105-56282127 TCAAATAAGCAACTATTGGTTGG + Intronic
1009052749 6:58297441-58297463 ACAAATCACCACAAATTGGGTGG + Intergenic
1009238355 6:61153143-61153165 ACAAATCACCACAAATTGGGTGG - Intergenic
1010097367 6:72062645-72062667 ACAAAGTACCAAAAACTGGGGGG + Intronic
1010617540 6:78030808-78030830 ACCAATCAGCAAGATTTGGGTGG + Intergenic
1010875907 6:81105406-81105428 ACTAATTACCACAAATTGGGTGG + Intergenic
1011000465 6:82582831-82582853 ACAAACTACCAAGAATTGAGTGG - Intergenic
1011138457 6:84125828-84125850 ACAAAATATCATAAATTGGGTGG - Intronic
1011464262 6:87639473-87639495 ATAAATTAGAATAAATTGGGGGG - Intronic
1011816290 6:91194916-91194938 ACAAAGTACCAAAAACTGGGTGG + Intergenic
1011938165 6:92808455-92808477 ACAAAATAAAAACATTTGGGAGG + Intergenic
1012063934 6:94522845-94522867 ACAAATTACCACACATTGGGTGG - Intergenic
1012087089 6:94841922-94841944 ACAAAATATCAGAAATTGGGTGG + Intergenic
1012809897 6:103944036-103944058 ATAAATTACCACCAACTGGGTGG + Intergenic
1014947067 6:127511271-127511293 ACAAAATACCAAAAACTGGGTGG - Intronic
1014995366 6:128136242-128136264 ACAAATTAGTACAAACTGGGTGG - Intronic
1015944613 6:138487119-138487141 ACAAAGTAAAAAAAATTGGGTGG + Intronic
1016393514 6:143598494-143598516 ACAAATTACCACCAATTTAGTGG - Intronic
1016799404 6:148153550-148153572 ACAAAATACCATAAATTGGGTGG - Intergenic
1016822659 6:148361195-148361217 ACAAAGCACCAATAATTGGGTGG - Intronic
1016908415 6:149173687-149173709 AGAAATTACCAAAAACTGGGTGG - Intergenic
1017035886 6:150266923-150266945 ACGAAGTAGCAAAAACTGGGTGG + Intergenic
1017809620 6:157975509-157975531 ACAAAGTACCAACAACTGGGTGG + Intergenic
1018274766 6:162118796-162118818 ACAAATTAGCAACATGGGCGTGG + Intronic
1018289635 6:162278631-162278653 ACAATTTGGGAACAATTGGGAGG + Intronic
1020452022 7:8330816-8330838 ACAATTTTTCAACATTTGGGGGG - Intergenic
1021775001 7:24044926-24044948 ACAAATTACCACAAATTTGGTGG - Intergenic
1021818296 7:24470735-24470757 ACAAATTACCAACATTAGGCAGG - Intergenic
1021863673 7:24932742-24932764 ACAAAATAGCATAAACTGGGTGG - Intronic
1022248580 7:28584680-28584702 ACAAATTACCACAAACTGGGTGG - Intronic
1022851099 7:34263015-34263037 ACAAATTACCACAAACTGGGTGG - Intergenic
1022878625 7:34563105-34563127 ACAAATTACCACAAACTGGGTGG - Intergenic
1023059464 7:36314265-36314287 ACAAATTACCATCAATTGAGAGG - Intergenic
1023633767 7:42188246-42188268 ACAAATTACCACAAACTGGGTGG - Intronic
1024408413 7:49009885-49009907 ACAAATTACCACAAATTTGGAGG - Intergenic
1024678597 7:51660581-51660603 ACAAAGTAGCACAAACTGGGTGG + Intergenic
1024783354 7:52877485-52877507 ACAAAATACCATCAACTGGGTGG + Intergenic
1027132801 7:75603427-75603449 ACAAATTCCCACTAATTGGGTGG - Intronic
1027309112 7:76935630-76935652 ACAAAGTACCACCGATTGGGTGG + Intergenic
1027730619 7:81867536-81867558 ACAAATTATCATAAACTGGGGGG + Intergenic
1027930947 7:84534263-84534285 ACAAATTACCACAAACTGGGTGG + Intergenic
1028239717 7:88404842-88404864 ACAAATTACCACAAACTGGGTGG - Intergenic
1028605424 7:92650482-92650504 ACAAATTACCACCAATTTAGTGG + Intronic
1028693445 7:93680929-93680951 ACAAATTAGCACAAATTTGATGG - Intronic
1029191531 7:98775626-98775648 AAAAATTAGCCAGCATTGGGGGG + Intergenic
1029491528 7:100873143-100873165 AAAAAGAAGCAACAATTGGCCGG - Intronic
1030173343 7:106626886-106626908 ACAAATTACCACAAACTGGGTGG - Intergenic
1030410502 7:109172742-109172764 ACAAATTAATACCAACTGGGTGG + Intergenic
1030477248 7:110051392-110051414 ACAAATTACCAAAAACCGGGTGG + Intergenic
1030930403 7:115516678-115516700 ACAAATTGCCATCAACTGGGTGG - Intergenic
1031029075 7:116715196-116715218 ACAAATTACCACAAACTGGGTGG + Intronic
1031096829 7:117430167-117430189 ACAAATTACCACAAACTGGGAGG + Intergenic
1031349950 7:120718703-120718725 ATAATTTAGAAACAATTGAGAGG + Intronic
1031432961 7:121695550-121695572 ACAAAGTACCACAAATTGGGTGG + Intergenic
1032894258 7:136233408-136233430 ACAAATTACCACCAACTGGATGG - Intergenic
1033461789 7:141553013-141553035 AAAAAATAGCAAAAACTGGGTGG + Intronic
1034052723 7:147999976-147999998 ACAAAGTACCAAAAACTGGGTGG - Intronic
1034107534 7:148503010-148503032 ACAAATTAGCACAAACTGGGTGG + Intergenic
1035957878 8:4102504-4102526 AAAACTTAGCGACAATGGGGAGG + Intronic
1038410575 8:27355550-27355572 ACAAATTACCACCAATTTAGTGG - Intronic
1039070905 8:33648539-33648561 ACACAGTAGAAAAAATTGGGAGG + Intergenic
1039179996 8:34855976-34855998 AGACCTTAGCAATAATTGGGTGG + Intergenic
1039739558 8:40369616-40369638 ATAAATTAGCAACAATGAGGAGG - Intergenic
1039854495 8:41400521-41400543 ACAAATTACCATAAATTCGGTGG - Intergenic
1041096639 8:54356735-54356757 ACATACTAGCAAAAATTGTGTGG + Intergenic
1041334138 8:56760681-56760703 ACAAAGTATCACAAATTGGGTGG + Intergenic
1041348235 8:56923467-56923489 ACAAATTACCATAAACTGGGTGG - Intergenic
1041625644 8:60023444-60023466 ACAATTTGGCAACAATGGTGTGG - Intergenic
1041705002 8:60837305-60837327 ACAAAATACCATAAATTGGGTGG + Intronic
1041979998 8:63846602-63846624 ACAAATTAGCACAAACTTGGTGG - Intergenic
1042326527 8:67534475-67534497 ACCAATTTACAACAGTTGGGAGG - Intronic
1042369677 8:67977333-67977355 ACAAATTACCATCAACTGAGTGG - Intronic
1042648601 8:71014296-71014318 ACAAATTATCACAAACTGGGTGG + Intergenic
1042716873 8:71783804-71783826 ACAAATGTCCAACAATTTGGTGG - Intergenic
1043302044 8:78745760-78745782 ACAAATTACCAAAAATTTGGAGG + Intronic
1043581991 8:81725019-81725041 ACAAATTAGCATCAATCTAGTGG + Intronic
1043742423 8:83830864-83830886 AGAGATTAGCAATAATTGAGAGG + Intergenic
1043861260 8:85319880-85319902 ACAAATAACAAACAAGTGGGAGG + Intergenic
1043984450 8:86677229-86677251 ACAAATTACCACAAACTGGGTGG - Intronic
1044109935 8:88259962-88259984 ACAAATAAGTAAAATTTGGGGGG - Intronic
1044963227 8:97551618-97551640 ACAAATTAGCCCAAACTGGGTGG + Intergenic
1045071276 8:98506977-98506999 ACAAATTACCACAAATTGAGTGG - Intronic
1045348530 8:101316764-101316786 ACAAAGTAGCACAAATTGGATGG - Intergenic
1045428895 8:102095020-102095042 ACAAATTAGAACAAATTGAGTGG - Intronic
1045473604 8:102534981-102535003 CCAAATTAGAAAAAATTGGCTGG + Intronic
1045822017 8:106349854-106349876 AGAAATCAGGAACAAGTGGGCGG + Intronic
1045858955 8:106794251-106794273 ACAAATTACCAAAAATTCAGTGG + Intergenic
1046064655 8:109182082-109182104 AGAAATTAGAAACAGTAGGGAGG - Intergenic
1046082841 8:109393515-109393537 GCAAATTAGCAACAATTGACTGG - Intronic
1046213923 8:111117144-111117166 ACAAATTACCACAAACTGGGTGG - Intergenic
1046355576 8:113081167-113081189 ACAAAATATCACAAATTGGGTGG + Intronic
1046490849 8:114951672-114951694 ACAAAATACCACCAACTGGGTGG - Intergenic
1047083524 8:121491494-121491516 AAAAATTAGCTACATTTGGTGGG - Intergenic
1047123721 8:121935254-121935276 ACAAATTACCAATGACTGGGTGG + Intergenic
1047212255 8:122849391-122849413 ACAAATTAGTACAAACTGGGTGG + Intronic
1047239919 8:123077643-123077665 ACAAACTAGCAACTATGGGCTGG - Intronic
1047291964 8:123539648-123539670 ACAAATCACAAACAAATGGGAGG + Intronic
1047361885 8:124176624-124176646 ACAAAGTACCACCAACTGGGTGG - Intergenic
1047421066 8:124708685-124708707 CCAAATTAGCAACAAAAGGAGGG + Intronic
1047967874 8:130060232-130060254 ACAAATGAGCAGCACTTGGCTGG - Intronic
1048542917 8:135359136-135359158 ACAAATTAGCACAAATTCAGTGG + Intergenic
1048677272 8:136797541-136797563 ACAAAATATCAAGAACTGGGTGG - Intergenic
1049324258 8:142013843-142013865 ACACATTAGCACAAATTTGGTGG + Intergenic
1049630634 8:143653957-143653979 ACAAAATACCATCAACTGGGAGG + Exonic
1050139930 9:2507042-2507064 ACAAATTAGAACCACCTGGGAGG + Intergenic
1050460937 9:5876820-5876842 ACAAAGTAACACAAATTGGGTGG - Intergenic
1050613106 9:7373486-7373508 ACAAAATACCATCAACTGGGTGG - Intergenic
1050635177 9:7604879-7604901 ACAAATTAGCACAAACTTGGTGG - Intergenic
1050966296 9:11807456-11807478 ACAAATTAGCACAAAGTGGATGG - Intergenic
1051060097 9:13035864-13035886 ACAAAATACCAAAAACTGGGTGG + Intergenic
1051741769 9:20259288-20259310 ACAAATTACCACAAATTGTGTGG - Intergenic
1052122407 9:24734117-24734139 ACAAATTAGCATCAATAGGTAGG + Intergenic
1052234427 9:26192846-26192868 ACAAATTAGCATGGACTGGGTGG - Intergenic
1053268006 9:36729919-36729941 ACAAATTACCACAAACTGGGTGG - Intergenic
1053461379 9:38273943-38273965 ACAAAATACCATCGATTGGGTGG - Intergenic
1054707559 9:68478484-68478506 ACAAATCACCACCAACTGGGTGG + Intronic
1055141335 9:72880451-72880473 ACAAATTGCCACAAATTGGGTGG - Intergenic
1055279171 9:74654823-74654845 ACAAAACAGCAACTTTTGGGGGG + Intronic
1055385461 9:75757231-75757253 ACAAATTACCACAAATTGGGTGG - Intergenic
1055786485 9:79874438-79874460 ACAAATTAGCACAAACTTGGTGG + Intergenic
1056442787 9:86637308-86637330 ACAAACTAGAGACAATTGGAAGG - Intergenic
1056548077 9:87629444-87629466 ACAAAGTAGCACAAATTGGGTGG - Intronic
1057333184 9:94135327-94135349 ACAAATTACCACCACCTGGGTGG + Intergenic
1057821329 9:98333331-98333353 ACAAACTACCATAAATTGGGCGG + Intronic
1058131158 9:101255044-101255066 TCAAATTAGCAAAAATTTGAAGG - Intronic
1062437908 9:136554819-136554841 ACAAATTACCAAAAATTTGGTGG - Intergenic
1186160779 X:6774857-6774879 GCACATTAGCATCATTTGGGAGG + Intergenic
1186310540 X:8313053-8313075 ACAAATTGCCACCAATTGAGTGG - Intergenic
1186689957 X:11964739-11964761 ACAAATTACCACAAATTTGGTGG + Intergenic
1186746811 X:12577884-12577906 ACAAAATACCAACGATTGGGTGG + Intronic
1186754816 X:12659195-12659217 ACAAGTTAGCAACAATGAGTAGG - Intronic
1187544239 X:20231923-20231945 ACAAATTACCACAAACTGGGTGG - Intronic
1188097352 X:26041607-26041629 ACCAATTAGCAGGATTTGGGTGG + Intergenic
1188280995 X:28269243-28269265 AAAAATTAGCAACATCTAGGAGG + Intergenic
1189114682 X:38330384-38330406 ACAAATTACCATCAACTTGGTGG - Intronic
1189567847 X:42261765-42261787 ACAAATTACCAAAAATTTAGTGG - Intergenic
1189770662 X:44423112-44423134 ACAAATTGCCATAAATTGGGTGG + Intergenic
1190133626 X:47773816-47773838 ACAAATTACCACAAACTGGGTGG - Intergenic
1190227061 X:48554396-48554418 AAAAATTAGCAAAAATTAGCCGG + Intronic
1191196860 X:57733365-57733387 ATAAATTAGCAGAAAATGGGGGG + Intergenic
1191727302 X:64294577-64294599 ACAAAATACCATAAATTGGGTGG + Intronic
1192456398 X:71279745-71279767 ACAAATTACCACAAATTTGGTGG - Intergenic
1192559881 X:72120911-72120933 ACAAATGAGCAACACTTGGCTGG - Intergenic
1192596617 X:72415050-72415072 TCAAAATAAAAACAATTGGGAGG - Intronic
1192910018 X:75593469-75593491 ACAAAGTACCAGCAACTGGGTGG - Intergenic
1194427896 X:93762542-93762564 ACAAATTAGTATAAATTTGGTGG + Intergenic
1194599428 X:95902147-95902169 AAAAATTAGCAACATTTGTTAGG - Intergenic
1195028827 X:100906652-100906674 ACAAATTACCAAAAACTAGGTGG + Intergenic
1195740837 X:108063183-108063205 AATAAATAGCAACAATTGGCAGG + Intronic
1196046067 X:111257791-111257813 ACATATTCACAACATTTGGGTGG + Intronic
1196686524 X:118514903-118514925 ACAAATTACCACAAATTGGGTGG + Intronic
1197231211 X:124005767-124005789 ACAAAGTAGCACAAACTGGGTGG + Intronic
1197360211 X:125492453-125492475 AAAAATAAGCAACAATGAGGTGG + Intergenic
1197419758 X:126224160-126224182 ACAAAATAGCATAAAGTGGGTGG - Intergenic
1198098467 X:133403237-133403259 ACAAAATACCAAAGATTGGGTGG + Intronic
1198671183 X:139082754-139082776 ACAAATTACCACAAATTGGATGG - Intronic
1198710045 X:139491549-139491571 ACAAAGTACCAAAAACTGGGTGG + Intergenic
1199973690 X:152878803-152878825 ACAAAGTACCACAAATTGGGTGG - Intergenic
1200793909 Y:7323298-7323320 ACAAAGTAGCATAGATTGGGTGG + Intergenic