ID: 1099928420

View in Genome Browser
Species Human (GRCh38)
Location 12:89045946-89045968
Sequence GGAAAGTCCTTGGGTAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099928416_1099928420 -9 Left 1099928416 12:89045932-89045954 CCATAGTAAAACCAGGAAAGTCC No data
Right 1099928420 12:89045946-89045968 GGAAAGTCCTTGGGTAAATCTGG No data
1099928413_1099928420 26 Left 1099928413 12:89045897-89045919 CCAGGACTTGGGGGGCTTCCAGA No data
Right 1099928420 12:89045946-89045968 GGAAAGTCCTTGGGTAAATCTGG No data
1099928412_1099928420 27 Left 1099928412 12:89045896-89045918 CCCAGGACTTGGGGGGCTTCCAG No data
Right 1099928420 12:89045946-89045968 GGAAAGTCCTTGGGTAAATCTGG No data
1099928414_1099928420 8 Left 1099928414 12:89045915-89045937 CCAGAATGCAGAAATTTCCATAG No data
Right 1099928420 12:89045946-89045968 GGAAAGTCCTTGGGTAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099928420 Original CRISPR GGAAAGTCCTTGGGTAAATC TGG Intergenic
No off target data available for this crispr