ID: 1099932053

View in Genome Browser
Species Human (GRCh38)
Location 12:89086252-89086274
Sequence CTCAAGCACCTGTCTACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099932053_1099932058 -7 Left 1099932053 12:89086252-89086274 CCCATGGTAGACAGGTGCTTGAG No data
Right 1099932058 12:89086268-89086290 GCTTGAGGAAAGGAAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099932053 Original CRISPR CTCAAGCACCTGTCTACCAT GGG (reversed) Intergenic
No off target data available for this crispr