ID: 1099933202

View in Genome Browser
Species Human (GRCh38)
Location 12:89097416-89097438
Sequence CCTTTTATCCAGGAGTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099933198_1099933202 -1 Left 1099933198 12:89097394-89097416 CCCAGATTTTGTTCAATTAGTGC No data
Right 1099933202 12:89097416-89097438 CCTTTTATCCAGGAGTTCCATGG No data
1099933199_1099933202 -2 Left 1099933199 12:89097395-89097417 CCAGATTTTGTTCAATTAGTGCC No data
Right 1099933202 12:89097416-89097438 CCTTTTATCCAGGAGTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099933202 Original CRISPR CCTTTTATCCAGGAGTTCCA TGG Intergenic
No off target data available for this crispr