ID: 1099937933

View in Genome Browser
Species Human (GRCh38)
Location 12:89150414-89150436
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099937933_1099937939 25 Left 1099937933 12:89150414-89150436 CCACAAACCATGCCCACGTAAGA No data
Right 1099937939 12:89150462-89150484 TGTGACATCACTAATCATCAGGG No data
1099937933_1099937938 24 Left 1099937933 12:89150414-89150436 CCACAAACCATGCCCACGTAAGA No data
Right 1099937938 12:89150461-89150483 GTGTGACATCACTAATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099937933 Original CRISPR TCTTACGTGGGCATGGTTTG TGG (reversed) Intergenic
No off target data available for this crispr