ID: 1099942754

View in Genome Browser
Species Human (GRCh38)
Location 12:89209054-89209076
Sequence AATCATACTCTGCAGCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099942752_1099942754 15 Left 1099942752 12:89209016-89209038 CCTTCACAGAAAAAAACACCGTG No data
Right 1099942754 12:89209054-89209076 AATCATACTCTGCAGCAGACTGG No data
1099942753_1099942754 -3 Left 1099942753 12:89209034-89209056 CCGTGAAAGAGTCTTCTTTAAAT No data
Right 1099942754 12:89209054-89209076 AATCATACTCTGCAGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099942754 Original CRISPR AATCATACTCTGCAGCAGAC TGG Intergenic
No off target data available for this crispr