ID: 1099943567

View in Genome Browser
Species Human (GRCh38)
Location 12:89218927-89218949
Sequence ATGTTTGAACAGATGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099943567_1099943569 19 Left 1099943567 12:89218927-89218949 CCATGCTTCATCTGTTCAAACAT No data
Right 1099943569 12:89218969-89218991 AATCTGAAAAAATAACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099943567 Original CRISPR ATGTTTGAACAGATGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr