ID: 1099947186

View in Genome Browser
Species Human (GRCh38)
Location 12:89258123-89258145
Sequence TCTAGAAAATAGGCTTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099947186_1099947191 1 Left 1099947186 12:89258123-89258145 CCCATCTAAGCCTATTTTCTAGA No data
Right 1099947191 12:89258147-89258169 AACCAGAAGGAGTGGTGTTATGG No data
1099947186_1099947190 -7 Left 1099947186 12:89258123-89258145 CCCATCTAAGCCTATTTTCTAGA No data
Right 1099947190 12:89258139-89258161 TTCTAGATAACCAGAAGGAGTGG No data
1099947186_1099947192 2 Left 1099947186 12:89258123-89258145 CCCATCTAAGCCTATTTTCTAGA No data
Right 1099947192 12:89258148-89258170 ACCAGAAGGAGTGGTGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099947186 Original CRISPR TCTAGAAAATAGGCTTAGAT GGG (reversed) Intergenic
No off target data available for this crispr