ID: 1099948954

View in Genome Browser
Species Human (GRCh38)
Location 12:89278593-89278615
Sequence AGATGCATGAACCCCAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099948951_1099948954 6 Left 1099948951 12:89278564-89278586 CCCAGATGATTGTCTGTAGCCAA No data
Right 1099948954 12:89278593-89278615 AGATGCATGAACCCCAATCTTGG No data
1099948950_1099948954 7 Left 1099948950 12:89278563-89278585 CCCCAGATGATTGTCTGTAGCCA No data
Right 1099948954 12:89278593-89278615 AGATGCATGAACCCCAATCTTGG No data
1099948952_1099948954 5 Left 1099948952 12:89278565-89278587 CCAGATGATTGTCTGTAGCCAAT No data
Right 1099948954 12:89278593-89278615 AGATGCATGAACCCCAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099948954 Original CRISPR AGATGCATGAACCCCAATCT TGG Intergenic
No off target data available for this crispr