ID: 1099954046

View in Genome Browser
Species Human (GRCh38)
Location 12:89335336-89335358
Sequence AGGTGTACACACATGGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099954042_1099954046 20 Left 1099954042 12:89335293-89335315 CCTAAGACAATCAGTCTTTTCAG No data
Right 1099954046 12:89335336-89335358 AGGTGTACACACATGGACGTGGG No data
1099954040_1099954046 29 Left 1099954040 12:89335284-89335306 CCTTTCCTTCCTAAGACAATCAG No data
Right 1099954046 12:89335336-89335358 AGGTGTACACACATGGACGTGGG No data
1099954039_1099954046 30 Left 1099954039 12:89335283-89335305 CCCTTTCCTTCCTAAGACAATCA No data
Right 1099954046 12:89335336-89335358 AGGTGTACACACATGGACGTGGG No data
1099954041_1099954046 24 Left 1099954041 12:89335289-89335311 CCTTCCTAAGACAATCAGTCTTT No data
Right 1099954046 12:89335336-89335358 AGGTGTACACACATGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099954046 Original CRISPR AGGTGTACACACATGGACGT GGG Intergenic
No off target data available for this crispr