ID: 1099955734

View in Genome Browser
Species Human (GRCh38)
Location 12:89351580-89351602
Sequence AGGGGCGCAGGGCTGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 11, 3: 77, 4: 646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099955734_1099955751 22 Left 1099955734 12:89351580-89351602 CCCGCCCGCAGCCCTGCGCCCCT 0: 1
1: 0
2: 11
3: 77
4: 646
Right 1099955751 12:89351625-89351647 TCCCTGGGCGCGTACCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1099955734_1099955742 -4 Left 1099955734 12:89351580-89351602 CCCGCCCGCAGCCCTGCGCCCCT 0: 1
1: 0
2: 11
3: 77
4: 646
Right 1099955742 12:89351599-89351621 CCCTAGCCCTGCCCCGCGCGCGG 0: 1
1: 1
2: 5
3: 30
4: 211
1099955734_1099955748 7 Left 1099955734 12:89351580-89351602 CCCGCCCGCAGCCCTGCGCCCCT 0: 1
1: 0
2: 11
3: 77
4: 646
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955734_1099955746 6 Left 1099955734 12:89351580-89351602 CCCGCCCGCAGCCCTGCGCCCCT 0: 1
1: 0
2: 11
3: 77
4: 646
Right 1099955746 12:89351609-89351631 GCCCCGCGCGCGGAGTTCCCTGG 0: 1
1: 0
2: 2
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099955734 Original CRISPR AGGGGCGCAGGGCTGCGGGC GGG (reversed) Intronic
900154398 1:1198212-1198234 AGGGGCACAGGGTGGTGGGCGGG - Intergenic
900188480 1:1343651-1343673 AGGGGTGCAGGGCAGGGGTCAGG - Intronic
900189941 1:1349131-1349153 CGGGGCGCAGGCGGGCGGGCGGG - Intronic
900205011 1:1427932-1427954 GCGGGGGCGGGGCTGCGGGCGGG - Intergenic
900341488 1:2191391-2191413 AGGGGAGCAGGGCTGCAGGGTGG + Intronic
900414004 1:2526772-2526794 AGAGGCCCGGGGCTGCGGGCGGG + Intergenic
900421143 1:2556448-2556470 AGGGGCTCAGGCCTGCTGGGTGG - Exonic
900605770 1:3522918-3522940 AGCCCCGCAGGGCAGCGGGCTGG + Intronic
900685584 1:3945842-3945864 AGGGGAGCAAGGCTGGGGGAGGG - Intergenic
900936439 1:5769127-5769149 AGTGGCCCAGGGCGGTGGGCTGG - Intergenic
900970815 1:5991788-5991810 AGGGGCGGAGGGGCGCGGCCAGG + Intronic
901635369 1:10667940-10667962 AGGGGCCTGGGGCTGGGGGCGGG - Intronic
901676442 1:10888666-10888688 AGGGGCGGAGGGGCGCGGGGTGG + Intergenic
901691176 1:10974146-10974168 GGAGGGCCAGGGCTGCGGGCCGG + Intronic
901930965 1:12595869-12595891 AGGGGAGCCGGGCTGGGGGCCGG + Intronic
902110461 1:14074276-14074298 AGGGGCTGGGGGCTGGGGGCTGG - Intergenic
902289236 1:15426025-15426047 AGGGGAGTGGGGCTGGGGGCCGG - Intronic
902332727 1:15738444-15738466 AGGGTGGCAGGGCTGGGGGATGG + Intronic
902336774 1:15758712-15758734 AGCGGCGCGGGGCGGCGGGGCGG + Intronic
902544750 1:17183348-17183370 ATGGGTGCAGGACTGAGGGCTGG - Intergenic
902641437 1:17768740-17768762 AGGGGCGAAGGCCTGGAGGCTGG + Intronic
902666990 1:17946509-17946531 GGGGGAGCAGGGATGAGGGCAGG + Intergenic
903142960 1:21350690-21350712 AGGGGCCCAGGGCAGGGGGAAGG - Intergenic
903178727 1:21595038-21595060 AGGAGAGCAGGTCTGCGGGGTGG - Intergenic
903220860 1:21868999-21869021 AGGGGAGCAGGGGTGGGGGTGGG + Intronic
903263197 1:22142373-22142395 AGCTGCGCCGCGCTGCGGGCTGG - Intronic
903555034 1:24187166-24187188 AAGGGCGCGGGGCCGCGGGAGGG - Intronic
903738358 1:25544197-25544219 TGGGGCGCAGGGGTGCGGGACGG - Intronic
904215330 1:28914519-28914541 AGGGGCGCGGGCCGGCGGGCGGG + Intronic
904483299 1:30807399-30807421 AGGGGCGGCGGGCGGCGGCCCGG - Intergenic
904603823 1:31688393-31688415 AGGGGAGGAGTGGTGCGGGCGGG - Intronic
904751063 1:32741762-32741784 CGGGGCGCAGGCCGGCGGGGAGG - Intergenic
905375054 1:37514539-37514561 GGGGGCGCGGCGCGGCGGGCCGG - Intronic
906204509 1:43979662-43979684 AGGGGCGCCGGAGTGGGGGCGGG - Intronic
906306914 1:44725280-44725302 GGAGGCACAGGGCTGCAGGCAGG - Exonic
906919390 1:50048100-50048122 TGGGGCGGAGCGCGGCGGGCGGG - Intronic
907462924 1:54615972-54615994 AGGGCCAGAGGGCTGGGGGCCGG + Intronic
908796094 1:67832938-67832960 CGGGGCGCACGGCCGCAGGCTGG + Intronic
910678990 1:89843553-89843575 AGGAGTGCAGGGCGGCGGGGAGG - Intronic
910711448 1:90186482-90186504 TGGGGCACAGGGCTGAGGGCTGG + Intergenic
910773392 1:90851607-90851629 GCGGGCGCAGGACTGCAGGCTGG - Intergenic
910957403 1:92721527-92721549 AGGGGTGGAGGGCTGGGGGAGGG + Intronic
911178789 1:94843106-94843128 AGAGGAGCAGGGCTGGGGGCTGG + Intronic
911399180 1:97353308-97353330 AGAGGGGCAGGGCTGCGGAATGG + Intronic
912385851 1:109270857-109270879 TGGGAAGTAGGGCTGCGGGCAGG - Intronic
912430010 1:109624048-109624070 AGGGGCACAGGGCTGCTGGCCGG + Intronic
912624675 1:111197322-111197344 AGGAGCACAAGGCTGAGGGCTGG + Intronic
912795142 1:112688866-112688888 AGGGAGGCAGGGCGGCGGGTGGG - Intronic
912812219 1:112803080-112803102 AGGAGGGCAGGACTGTGGGCTGG - Intergenic
913658387 1:120983367-120983389 TGAGGCGCCGGGCTGCGGGTGGG + Intergenic
914009747 1:143766454-143766476 TGAGGCGCCGGGCTGCGGGCGGG + Intergenic
914648365 1:149675115-149675137 TGAGGCGCCGGTCTGCGGGCGGG + Intergenic
914754361 1:150554354-150554376 AGGGGGGCAGGGCTGCGGTGAGG - Exonic
914845597 1:151282183-151282205 AGGGGCACAGGGCTGAGCGACGG + Intronic
915468760 1:156113687-156113709 GGGGAAGCAGGGCTGGGGGCTGG - Intronic
915475678 1:156151384-156151406 AGGGGTGCACTGCTGGGGGCAGG + Intronic
915557271 1:156667715-156667737 TTGGGCTCAGGGCTGAGGGCTGG - Intergenic
915580090 1:156808370-156808392 AGGGGCTCAGGGATGCTGGGGGG + Intronic
915626185 1:157115434-157115456 AGGGGAGCAGGGCTGAGAGCAGG - Intergenic
915940677 1:160116440-160116462 AGGGGTGCTGGGGTGGGGGCTGG - Intronic
916039536 1:160950532-160950554 AGGTACACAGGGCTGCTGGCTGG - Exonic
916144550 1:161727160-161727182 AGGGGCGTAGGGCGGTGGGCGGG - Intronic
916588288 1:166166589-166166611 AGGGGCGGGGGGCTCCGGCCCGG - Exonic
917919956 1:179743233-179743255 AGGTGGCCAGGGCTGGGGGCAGG - Exonic
918066512 1:181105345-181105367 CGCGGCGCGGCGCTGCGGGCTGG + Intergenic
918299155 1:183186397-183186419 AGGTGGCCCGGGCTGCGGGCAGG - Exonic
918432379 1:184475324-184475346 GGGGGGGCAGGGCTGAGGACTGG - Intronic
919748260 1:201021883-201021905 AGGGGTGCATGGCTGGGGGGTGG - Intronic
920333381 1:205228137-205228159 CGGGGCGCGGGGCAGCCGGCCGG - Intergenic
920692130 1:208155070-208155092 AAGGGAGCAGGACTGCGGGGAGG + Intronic
920924449 1:210328762-210328784 AGGGGCCCCGGGCCGCCGGCGGG + Intronic
921390535 1:214609083-214609105 TGGGGCCCAGGGGCGCGGGCCGG - Intronic
922116290 1:222617886-222617908 ACGGGGGCAGGGACGCGGGCAGG - Intergenic
922566317 1:226604060-226604082 TGGGGTGAAGGGCTGTGGGCTGG - Exonic
922764390 1:228149796-228149818 TGGGGGGCAGGGCAGCGGGCAGG - Intergenic
922769408 1:228173935-228173957 AGCTGCGCACGGCTGTGGGCAGG + Intronic
923008019 1:230067443-230067465 AGGGGCGCAGGGTGGGGGGTGGG - Intronic
924436839 1:244049342-244049364 GGGTGCGGAGGGCGGCGGGCTGG + Intronic
1062774696 10:135473-135495 AGAGGCGCCGGGCGGCGGGAAGG + Intronic
1062833823 10:623539-623561 AGGGATGCAGGGCTGAGGGGAGG + Intronic
1062833834 10:623567-623589 AGGGATGCAGGGCTGAGGGGAGG + Intronic
1063665118 10:8056155-8056177 AGAGACGGAGGGCTGCGGCCTGG - Intronic
1065188553 10:23191763-23191785 AGGTGCGCGGGGCTCCGGCCTGG - Intergenic
1066020821 10:31299285-31299307 AGGTGAGCAGAGCTGCTGGCTGG + Intergenic
1066752035 10:38667838-38667860 AGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1067288333 10:44923714-44923736 AGGGGGGCAGAGGTGTGGGCTGG - Intronic
1067474290 10:46556132-46556154 AGGGCAGCAAGGCTGGGGGCGGG + Intergenic
1067576068 10:47409443-47409465 ACTGGCACAGGGCTGCGAGCTGG + Intergenic
1067785526 10:49242867-49242889 AGGGGCACTGGGCTGGGAGCAGG - Intergenic
1069886904 10:71629466-71629488 AGAGGCCCAGGGCTGTGGTCAGG + Intronic
1070623767 10:78034042-78034064 AGGGGCTCGGGGCTGTTGGCAGG + Intronic
1070750011 10:78958501-78958523 AGGCAGGCAGGGCTGGGGGCTGG - Intergenic
1070782408 10:79145352-79145374 AGGTGTGCTGGGCTGGGGGCTGG + Intronic
1070877258 10:79826012-79826034 AGGGGTCCCGGGCGGCGGGCGGG - Intergenic
1071643755 10:87342056-87342078 AGGGGTCCCGGGCGGCGGGCGGG - Intergenic
1071997737 10:91163563-91163585 CGGGGCGCGCGGCTGCCGGCGGG - Intronic
1072190107 10:93071683-93071705 AGGGGGGCAGGGCGGGGGGTGGG - Intergenic
1072538528 10:96381189-96381211 AGGGCAGCAGGGCAGGGGGCAGG - Intronic
1072578442 10:96720477-96720499 AGGGGCGCCGGGCTCCGCGCGGG + Exonic
1072980419 10:100093561-100093583 AGGGGGGCGGGGCGGCTGGCCGG - Intergenic
1073057165 10:100710185-100710207 AGGGGGGTCGGGCTGCGCGCGGG - Intergenic
1075092511 10:119451644-119451666 ACGGAAGCAGGGGTGCGGGCAGG - Intronic
1075119134 10:119651587-119651609 AGGGGCCCACGGCGGCGGCCCGG + Exonic
1075122189 10:119672398-119672420 AGGAGGGCTGGGCTGCTGGCCGG - Exonic
1075522285 10:123150124-123150146 GGCGGCGCGGGGCGGCGGGCCGG - Exonic
1076629602 10:131844262-131844284 TGGGGCTCAGGACTGCTGGCGGG - Intergenic
1076735858 10:132458652-132458674 AGGTGGGCACGGCAGCGGGCTGG - Intergenic
1076736617 10:132461974-132461996 CCGGGTGCAGGGCTGCAGGCTGG - Intergenic
1076767320 10:132643765-132643787 AGTGGCGCAGGGCTGGGCACAGG - Intronic
1076888993 10:133274908-133274930 ATGAGCCCAGGGCAGCGGGCAGG + Intronic
1076916097 10:133423749-133423771 AGGGGCGGAGGGCTCAAGGCTGG + Intronic
1077018090 11:405791-405813 AGGGTCCCAGGGCTGCTGGCAGG + Exonic
1077048699 11:557134-557156 ACGGGGGCAGGGCTGGGGTCTGG - Intronic
1077065536 11:639559-639581 GGGGGCGCCGGGGCGCGGGCGGG - Intronic
1077192235 11:1260311-1260333 CAGGGGGCAGGGCTGTGGGCGGG - Intronic
1077218453 11:1404837-1404859 AGGCTCGCCGGGCTGGGGGCAGG + Intronic
1077248302 11:1549606-1549628 AAGGGCGCAGGGCACAGGGCAGG - Intergenic
1077367076 11:2165614-2165636 AGAGGGGCAGGGCTGGGGGACGG - Intronic
1077476503 11:2792864-2792886 AGGGGCAGGGGGCTGCGTGCTGG - Intronic
1077497380 11:2892682-2892704 GAGGGCGCCGGGCTGCCGGCCGG - Intronic
1080384826 11:31805144-31805166 AGGGGCGCGGGGTCGCGGGCCGG - Intronic
1080385815 11:31810597-31810619 AGCGGCGCAGGGCTCGGGGCGGG - Intronic
1080457148 11:32428105-32428127 CGGGGTGCGAGGCTGCGGGCAGG + Intronic
1080727879 11:34916136-34916158 CTGGGCGCAGGGTAGCGGGCCGG - Intronic
1081527324 11:43935945-43935967 AGGGGCTCAGAGCTGTGGGAGGG - Intronic
1082002372 11:47400264-47400286 AGGGGGGCGGGGCCGGGGGCCGG - Intergenic
1082005690 11:47417897-47417919 AGGTGCTCAGGGCTGCTAGCTGG + Intergenic
1082784539 11:57309657-57309679 AGGGCAGCAGGGATGCTGGCCGG - Exonic
1082877300 11:58001325-58001347 AGAGGCACAGGGATGAGGGCTGG - Intergenic
1083171211 11:60924892-60924914 AGGGGCGAGTGGCTGGGGGCAGG - Intronic
1083299051 11:61730744-61730766 AGGCTCCCAGGGCTCCGGGCAGG - Intronic
1083307968 11:61770579-61770601 GGGTGGGCAGGGCGGCGGGCAGG + Intronic
1083631149 11:64096142-64096164 AGGGGACCAGGGCTGCCCGCCGG + Intronic
1083656195 11:64230842-64230864 AGGGCGGCATGGCGGCGGGCGGG - Exonic
1083782063 11:64923865-64923887 GGGGGCCCAGGACTGCAGGCTGG + Intronic
1084004338 11:66315170-66315192 GGGTGGGGAGGGCTGCGGGCTGG + Exonic
1084178943 11:67437183-67437205 AGGCGTGCAGGGCCGGGGGCTGG + Intronic
1084212437 11:67630268-67630290 AGGGACGGAGGGCGGCGGGGCGG + Intergenic
1084295764 11:68212960-68212982 CGGGGGGCGGGGCTGCGGCCGGG - Intronic
1084358147 11:68652895-68652917 CGGGGCCCAGGGCTGAGGGAGGG - Intergenic
1084362495 11:68677856-68677878 TGGGGGGCGGGGCTGGGGGCTGG + Intergenic
1084516836 11:69642094-69642116 AGGGGCGCAGGGACGCGGCATGG + Intronic
1084517957 11:69646608-69646630 AGGGGCCCTGGGCTGGGAGCCGG - Intronic
1084640396 11:70422663-70422685 AGGGGCGGCGGGCAGCAGGCAGG - Intronic
1085123574 11:73982693-73982715 AAGGGCGCAGGGCTGGGGCCAGG + Intronic
1085400948 11:76235179-76235201 AGGGGCTGGGGGCGGCGGGCTGG - Intergenic
1085474833 11:76783277-76783299 GGGGGAGCCTGGCTGCGGGCGGG + Intronic
1089063335 11:115643723-115643745 AGGGGCACAGGGCAGCGTTCTGG + Intergenic
1089333304 11:117705038-117705060 AGGGGGGGACGTCTGCGGGCTGG + Intronic
1089396134 11:118137198-118137220 AGAGGCACAGGGCTGGGTGCAGG - Intronic
1089442054 11:118525522-118525544 AGGCGAGCAGGGTGGCGGGCTGG - Exonic
1090327818 11:125904326-125904348 AGGGGCGGAGGGCAGAGAGCGGG - Intronic
1090344909 11:126062428-126062450 GGGGGTGCAGGGCTGCGTGCGGG - Intronic
1091261314 11:134236791-134236813 AGAGGCCCAGGGCTGAGGGAAGG + Intronic
1091282768 11:134391381-134391403 TGGGGCCCAGAGCTGGGGGCAGG - Exonic
1091394131 12:143203-143225 AGGGGAGCTGGGCTGGGGGCTGG + Intronic
1091449461 12:563328-563350 CAGGGCGCAGGGGTGTGGGCAGG - Exonic
1091616159 12:2052797-2052819 CGGGGCGCACGGCGGCGGACTGG - Intronic
1091688999 12:2583151-2583173 AGCGGCGCCGCGCTCCGGGCGGG + Intronic
1092122860 12:6056822-6056844 CGGCCCGGAGGGCTGCGGGCAGG + Intronic
1092147824 12:6226942-6226964 GGGGGAGCAGGTCTGCCGGCAGG + Intronic
1092245711 12:6863230-6863252 AGGGGCACAGGGCTGCAGCCCGG + Exonic
1092246672 12:6867813-6867835 AGGGCCGCTGGGGTCCGGGCAGG + Intronic
1092258014 12:6937494-6937516 GGGGGCGAGGGGCTGCGGGCTGG - Exonic
1092443499 12:8531005-8531027 AGGGCCACAGGGCACCGGGCAGG - Intergenic
1092539792 12:9413632-9413654 AGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1094486019 12:30926634-30926656 GTGGGCGCAGGGGCGCGGGCCGG + Intronic
1095446347 12:42286859-42286881 AGGAGCGCAGGGTATCGGGCGGG + Intronic
1095476286 12:42589927-42589949 CCGGGGGCAGGGCTGCGAGCAGG + Intronic
1095976339 12:47943122-47943144 AGGAGGGCAGGCCTGGGGGCTGG - Intergenic
1096156796 12:49345597-49345619 AGCGGCGCAGGGCAGAGGGTCGG + Intergenic
1096220560 12:49826138-49826160 AGGTGGGCAGGGCTGGGGGTGGG + Intronic
1096835750 12:54350176-54350198 AGGGGCGGCGGGCAGGGGGCGGG - Intronic
1096863949 12:54550055-54550077 ACTGGAGCAGGGCTGTGGGCTGG + Intronic
1097120105 12:56725063-56725085 AGGGTAGAAGGGCTGCGGGGCGG - Intronic
1097190426 12:57216887-57216909 AGGGACGCGGGGCTCCGGGCGGG - Exonic
1097938640 12:65279359-65279381 GGGGGTGCGGGGCGGCGGGCAGG + Intronic
1099955734 12:89351580-89351602 AGGGGCGCAGGGCTGCGGGCGGG - Intronic
1102440789 12:112962735-112962757 CTGGGAGCAGGGCTGCAGGCAGG + Exonic
1103358949 12:120342483-120342505 AGGAGGGCAGGGCTGCGGGGAGG - Exonic
1103365226 12:120377431-120377453 AGGGGTGCCAGGCTGCAGGCAGG + Intergenic
1103497586 12:121374710-121374732 AGGAGCTCAGGGCGGGGGGCAGG - Intronic
1103775707 12:123364945-123364967 AGGGGCGCAGAGAGGCGGGTGGG - Intergenic
1103954292 12:124567704-124567726 CGGGGCGCGTCGCTGCGGGCGGG - Intergenic
1104685740 12:130782905-130782927 AGGGGCTCAGGACTGGGAGCTGG - Intergenic
1104746748 12:131215475-131215497 AGGGAGGCAGAGCTGAGGGCAGG + Intergenic
1104896554 12:132167728-132167750 AGAGGCTCAGGGCTCCGGGCAGG - Intergenic
1104977195 12:132557468-132557490 TGGGGCGCAGGGCTGTGGGGCGG + Intronic
1105291926 13:19058767-19058789 AGGGGCCCAGCACTGCCGGCAGG + Intergenic
1105418174 13:20231349-20231371 GGGAGTGCAGAGCTGCGGGCAGG + Intronic
1106157611 13:27172127-27172149 AGGACCGCAGGGACGCGGGCAGG - Intergenic
1106241710 13:27918368-27918390 AGGGAAGCACGGCGGCGGGCGGG - Intergenic
1106246353 13:27953812-27953834 AAGGGCGCTGGGCTGCGGGTGGG - Intergenic
1107946035 13:45418410-45418432 GGCGGCGCGGGGCTGCGTGCAGG - Intronic
1108676021 13:52738930-52738952 AGGGGCGCGCGGCTGCCGGCGGG - Intronic
1109274156 13:60285807-60285829 TGGGGTGCAGGGGGGCGGGCAGG + Intergenic
1113120306 13:106917727-106917749 CAGGGCGCAGGGCAGAGGGCCGG + Intergenic
1113143733 13:107183843-107183865 AGGGGAGGAGGGCTGGGGGAGGG + Intronic
1113461291 13:110484395-110484417 AGGGGCCCAGAGCTGCGGGCCGG - Intronic
1114454213 14:22844997-22845019 GGAGGCGCAGTGCTGGGGGCAGG - Intronic
1114736791 14:25050251-25050273 AGGGGCTGGGGGCTGGGGGCCGG + Exonic
1114901191 14:27061163-27061185 AGGGGTGGAGGGCTGGGGGAGGG - Intergenic
1115545522 14:34462291-34462313 ATGGGCGCTGGGTGGCGGGCGGG - Exonic
1115566504 14:34629736-34629758 AGGGAGGAAGGGCTGCGGGAGGG + Intronic
1117315402 14:54567103-54567125 AGGGGCGCGGGGGTGGGGGTGGG - Intronic
1118320541 14:64749739-64749761 GGGGGCGCTGGGCAGAGGGCTGG + Exonic
1118916801 14:70114599-70114621 AGGAGGGCAGGGATGGGGGCAGG - Intronic
1119410278 14:74426080-74426102 GGCGGCGGCGGGCTGCGGGCGGG - Exonic
1119545705 14:75469918-75469940 CGAGGGGCAGGGCTGGGGGCAGG - Exonic
1119557951 14:75567814-75567836 AGGGGAGCAGGGCTGGGGGCAGG + Intergenic
1119753604 14:77098391-77098413 AGGGGAGCAGGGATGACGGCGGG + Intronic
1120859908 14:89245884-89245906 AGTGTCACAGGGCTGCGGGTTGG - Intronic
1121279162 14:92687273-92687295 AGGGGTGGAGGACGGCGGGCGGG + Intronic
1121323193 14:93004784-93004806 GGGGGCACAGGGTTGGGGGCTGG + Intronic
1121463674 14:94100812-94100834 AGAGGCTCAGGGCTGGGGGGAGG - Intronic
1121548882 14:94783189-94783211 GGGGGCCCAGGGCTGGGGCCTGG + Intergenic
1122077746 14:99246613-99246635 AGGGGCGCAGAGCTCCGCGGGGG - Intronic
1122145189 14:99684535-99684557 AGGTGAGCGGGGCTGGGGGCGGG + Exonic
1122162459 14:99793841-99793863 TGGGGCACAGGGCGGCGGGGAGG + Intronic
1122228373 14:100292645-100292667 GCGGGCGCTGGGCTGCGAGCCGG - Exonic
1122275099 14:100587124-100587146 AGGGGAGCGGGGCGGGGGGCCGG + Intronic
1122275202 14:100587426-100587448 CGGGGAGCCGGGCTGGGGGCGGG - Intergenic
1122356730 14:101127102-101127124 TGGGGCCCAGGCCTGAGGGCTGG - Intergenic
1122688261 14:103520208-103520230 CTGGGCACCGGGCTGCGGGCAGG - Exonic
1122740173 14:103867648-103867670 AGGGAGGCGGGGCTGGGGGCTGG + Intergenic
1122792077 14:104188190-104188212 AGGGGCGCAGGGGTGGGGCCTGG + Intergenic
1122796935 14:104210710-104210732 CGGGGGGCAGGGCTGGGGGAGGG + Intergenic
1122822657 14:104355004-104355026 AGGGGCTGGGGGCTGGGGGCTGG + Intergenic
1122959606 14:105088346-105088368 CCGGGCGGAGGGCTGGGGGCGGG + Intergenic
1122984617 14:105206438-105206460 TGGGGTGCAGGGGTGTGGGCAGG + Intergenic
1122984676 14:105206654-105206676 TGGGGTGCAGGGGTGTGGGCAGG + Intergenic
1123144175 14:106111706-106111728 AGGGGAGGAGGGTTGCTGGCAGG - Intergenic
1123220947 14:106854795-106854817 AGGGGAGGAGGGTTGCTGGCAGG - Intergenic
1125519295 15:40339273-40339295 ATAGGCGCAGGGCTGTGGACTGG + Intronic
1125626848 15:41116010-41116032 AGGGGGGGCGGGGTGCGGGCGGG + Exonic
1126417972 15:48438638-48438660 AGGAGGGCAGGGCTGTGGGTGGG + Intronic
1127453245 15:59136752-59136774 AGGGGCTGGGGGCTGGGGGCTGG - Exonic
1128115378 15:65102014-65102036 AGGGGACCGAGGCTGCGGGCTGG + Intronic
1128456376 15:67833843-67833865 GAGGGCGCAGGGGTGCGGCCAGG - Exonic
1128528904 15:68431198-68431220 AGGGGCGCGCGGCTGGGAGCGGG - Intronic
1129412234 15:75356362-75356384 GCGGGCGCTGGGCTGGGGGCTGG + Exonic
1129710723 15:77819204-77819226 AGGGGCGCAGGCCGGGGAGCCGG - Intronic
1129710727 15:77819212-77819234 AGGGCCGCAGGGGCGCAGGCCGG - Intronic
1129844873 15:78763678-78763700 AGGTGAGCCGGGCTGCGGGGAGG - Exonic
1129858687 15:78843489-78843511 AGGGGAGCAGGGCTGTGGCCTGG + Intronic
1130252273 15:82307371-82307393 AGGGGCTCAGGGCTGGGGGAGGG - Intergenic
1130967001 15:88705261-88705283 AGGGGCAGACGGCGGCGGGCCGG - Intergenic
1131059304 15:89394887-89394909 AGGGGCGGTGGGCTGGGGGGAGG - Intergenic
1131200086 15:90388532-90388554 TGGGGCGGCGGGCGGCGGGCGGG + Intronic
1131463583 15:92637163-92637185 AGAGGAGCAGGGCAGTGGGCAGG + Intronic
1131827418 15:96332194-96332216 CGGGGCGCCGGGCGGCGGGCCGG - Exonic
1132464987 16:73284-73306 AGGGGCACAGGGCAGGGGGAGGG - Intronic
1132585775 16:705304-705326 CGGGGCGCGGGGCTGCGGGAAGG + Intronic
1132651051 16:1021599-1021621 AGGGGTGCAGGGCCGTGGTCCGG + Intergenic
1132746318 16:1437796-1437818 AGGTGCGCCAGGCAGCGGGCGGG - Exonic
1132760868 16:1508086-1508108 AGGGGCCCAGGGAGGCGGGTGGG - Intronic
1132836340 16:1955033-1955055 CGGGGAGCAGGGCTGGGGACAGG + Intronic
1133304864 16:4802501-4802523 AGGCGCGCGGGCCAGCGGGCGGG - Intronic
1133973101 16:10580818-10580840 AGAGCCGCAGGGAGGCGGGCGGG - Intergenic
1134049366 16:11126152-11126174 TGTGGCGCAGGGCGGGGGGCTGG - Intronic
1134759147 16:16698229-16698251 AGGGGCACAGGGGAGGGGGCAGG - Intergenic
1134986926 16:18660955-18660977 AGGGGCACAGGGGAGGGGGCAGG + Intergenic
1136054971 16:27681556-27681578 AGGGGAGCAGGGCTGCGACTGGG + Intronic
1136105866 16:28030136-28030158 AGGGGAGGAGGGATGCTGGCAGG - Intronic
1136186402 16:28591188-28591210 AGGAGCCCAGGGCTCAGGGCAGG - Intronic
1136414441 16:30095175-30095197 AGGGGGTCAGGGCTGCCGGTGGG + Intronic
1136414663 16:30095997-30096019 TGGGGCGCGGGGGTGGGGGCGGG + Exonic
1136428873 16:30185847-30185869 GGGAGGGCAGGGCTGCGGGTGGG - Intronic
1136574960 16:31117900-31117922 CGGGGCCCAGGGCTGGGGGCGGG + Intronic
1136628729 16:31477090-31477112 AAGGGTGCAGGGCAGGGGGCGGG + Intronic
1137300386 16:47143496-47143518 AGGGACGCAGAGGCGCGGGCAGG + Intronic
1137547862 16:49416541-49416563 AGCGGCGCAGGGCTGGGGCCTGG + Intergenic
1137619741 16:49868407-49868429 AGGGGTGCGGGGCCGCCGGCGGG + Intergenic
1137665266 16:50246031-50246053 CGGGGCGGGGGGCTGGGGGCTGG - Intergenic
1138429741 16:56961066-56961088 AGGGCTGCAGGGATGTGGGCAGG - Intergenic
1138552039 16:57753533-57753555 GGGGACGCTGGGCTGGGGGCGGG - Intronic
1138591114 16:58000307-58000329 AGGGGCGCGGGGGGGCGGCCGGG + Intronic
1139513039 16:67438050-67438072 AGAGGGGCAGGGCTGAGGGAGGG + Exonic
1139705372 16:68737512-68737534 AGGGGCGCAGGGCTGGGGCGCGG - Intronic
1139707612 16:68752278-68752300 AGGTGGGGAGGGCTGAGGGCAGG - Intronic
1139956973 16:70697793-70697815 AGGGAGGCAGGGCTGTGGCCTGG + Intronic
1141594142 16:85087194-85087216 AGGCGGGCAGGGCTGGGGTCAGG + Intronic
1141677204 16:85524096-85524118 CGGGGCCCAGGTCTGGGGGCCGG + Intergenic
1141692614 16:85605172-85605194 AGGGGAGCAGGACAGCGGGTGGG - Intergenic
1141693690 16:85610367-85610389 GGGGGCGCGGGGCTGTGGGTAGG + Intergenic
1141944892 16:87303219-87303241 AGGGGTGCAGGGATGAGGGGTGG + Intronic
1142028472 16:87826914-87826936 TGGGGCGCAGGTCTGCGGGAAGG - Intergenic
1142290635 16:89192360-89192382 GGGGCCGCAGCGCTGCTGGCGGG + Exonic
1142312726 16:89323450-89323472 AGGGGGGCAGAGCCGAGGGCAGG + Intronic
1142489536 17:269379-269401 AGGGGGCCAGGGCTGAGGGTGGG - Intronic
1142659676 17:1419234-1419256 CGGGGCGCAGGGTGGGGGGCGGG - Intergenic
1142671862 17:1491306-1491328 GGCGGAGCAGGGCTGCGGGCGGG + Intronic
1142762356 17:2050047-2050069 AGGGCCGCGGGGGGGCGGGCGGG + Intergenic
1143016155 17:3892375-3892397 GGAGGCGCAGGGCTGGTGGCTGG - Intronic
1143513395 17:7407781-7407803 AGGGGAGAAGGGCTGCTGGGTGG + Intronic
1144695887 17:17303609-17303631 GGCGGCGCGGGGCGGCGGGCGGG + Exonic
1144775414 17:17782536-17782558 AGCCGCGCAAGGCTGCGGGCGGG - Intronic
1144834087 17:18147957-18147979 TGGGGCTGAGGGCTGCGGGGTGG - Intronic
1144850033 17:18239452-18239474 AGGGGCACATGGCTGGTGGCAGG - Intronic
1145750748 17:27353693-27353715 AGGGGCGCGCGGCTGCAGTCAGG + Intergenic
1146183272 17:30710048-30710070 CGGGGCGCGGGGGTGCGGACGGG + Intergenic
1146283463 17:31559573-31559595 AGGGGCGCGGGGCGCGGGGCAGG - Intergenic
1146322628 17:31858902-31858924 GGGGCCGCGGGGCTGCGGGGCGG - Intronic
1146398700 17:32487416-32487438 AGGGGCGCAGGGGCGCGGCGCGG + Intronic
1146787284 17:35731611-35731633 GGGGGTGCGGGGGTGCGGGCTGG - Intronic
1147179177 17:38674065-38674087 GGGGGCGCAGGGCAGCGGCCCGG + Exonic
1147264409 17:39225965-39225987 AGCGGCGTAGGGCAGGGGGCGGG - Intergenic
1147429541 17:40363030-40363052 CGGGGCGCACGGCTCGGGGCCGG + Exonic
1147586510 17:41656377-41656399 AGGAGCCCAGGGCTGTGGTCAGG + Intergenic
1147598854 17:41733830-41733852 AGGGGCGGGGGGCTGCGGGAGGG - Intronic
1147705507 17:42422526-42422548 AGGGGAGCAGCGCCACGGGCAGG + Intronic
1147790949 17:43014053-43014075 ATGGGAGAAGGGCTGGGGGCTGG - Intronic
1147907465 17:43832657-43832679 CGGGGCTCGGCGCTGCGGGCTGG - Intronic
1148029195 17:44608313-44608335 GGGGGCTGAGGGCTGAGGGCTGG + Intergenic
1148568540 17:48647881-48647903 AGGGTCTCAGGGCTGAGGTCAGG - Intergenic
1148640433 17:49183611-49183633 AGGGCCTGAGGGCTGGGGGCTGG - Intergenic
1148797434 17:50203781-50203803 AGGGGCGGGGAGCTGCAGGCAGG - Intergenic
1148936224 17:51166387-51166409 AGGGGCGCAGGGCGGAGCGCGGG - Intronic
1149610567 17:57955461-57955483 GGAGGAGCGGGGCTGCGGGCGGG + Intergenic
1149614652 17:57988020-57988042 AGGGGGGCCGGGCCCCGGGCTGG - Intronic
1149848641 17:60022017-60022039 TGAGGGGCAGGGCTGGGGGCGGG + Intergenic
1149861528 17:60124507-60124529 TGAGGGGCAGGGCTGGGGGCGGG - Intergenic
1151186822 17:72370954-72370976 AGGGACCCAGGCCTGCTGGCAGG + Intergenic
1151296804 17:73192328-73192350 GGGGGAGGAGGGCGGCGGGCTGG - Intergenic
1151511924 17:74566022-74566044 GGGGGGGCAGGGGGGCGGGCGGG + Intergenic
1151763912 17:76122395-76122417 AGAGGCACAGGGCTGCGGCCTGG + Intergenic
1152070453 17:78131544-78131566 TGGGGCGCCGGGCTGCCGGTGGG - Exonic
1152111040 17:78357943-78357965 AGGGCCCCAGGGCTGCGGGCTGG - Exonic
1152218030 17:79045691-79045713 AGGGGCGAAGGGATGGGGACAGG + Intronic
1152363746 17:79843950-79843972 AGGGGCGCAGGGGAGCGAGTTGG - Intergenic
1152405672 17:80096616-80096638 TGGGGCGCAGGGCCTGGGGCTGG - Intronic
1152435253 17:80272600-80272622 TGGGAGGCAGGGCTGCGGGGAGG - Intronic
1152644322 17:81461776-81461798 TGGAGCGCAGGGCCTCGGGCTGG - Exonic
1152649174 17:81484004-81484026 AGGGGCGCAGGGCAGAGGGTGGG + Intergenic
1152655915 17:81519213-81519235 AGGAGCGCGGGCCGGCGGGCTGG - Intronic
1152655918 17:81519221-81519243 GGGGGCGCAGGAGCGCGGGCCGG - Intronic
1152754560 17:82081860-82081882 AGGTGGGCAGAGCTGCGGGGAGG + Intronic
1152808761 17:82371493-82371515 AGGGGCGCAGGGGTGAACGCTGG + Intergenic
1152861341 17:82698385-82698407 AGGGGCGCGGGGCTGGGGAGGGG - Intronic
1152892019 17:82887713-82887735 AGAAAGGCAGGGCTGCGGGCAGG - Intronic
1153688582 18:7568558-7568580 CGGGGCGCAGGGCCGTGGCCAGG - Intronic
1153854923 18:9136599-9136621 GGCGGCGGAGGGGTGCGGGCCGG - Intronic
1154270217 18:12912086-12912108 AGGGACGCCGGGTTGCGGGGAGG - Intronic
1154329269 18:13416032-13416054 CAGGGCGCAGGGCTGAGGGCAGG + Intronic
1154333595 18:13449350-13449372 AGGGGCACATGGCAGGGGGCTGG + Intronic
1155268088 18:24113364-24113386 AGGAGCCCAGGTCTGCGGGTGGG + Intronic
1156350451 18:36297690-36297712 AGGCGCGCCGGGCTGCAGCCCGG - Intergenic
1156473309 18:37390808-37390830 GGGGGGGCAGTGCTGCTGGCCGG + Intronic
1157260826 18:46174342-46174364 AGGGGCGCAGGGCCGCGGCCTGG + Intronic
1157473690 18:48008321-48008343 GGGGGCGCTGGGCCGGGGGCGGG + Intergenic
1157483886 18:48073514-48073536 ACAGGCGCAGGGGTGCGGGCAGG + Intronic
1157615773 18:48986989-48987011 AGGGCTGCAGGGCTGCAGCCTGG - Intergenic
1159586560 18:70288727-70288749 AGGGGCGCGGGGGTGGGGGAAGG + Intergenic
1160004295 18:75058081-75058103 AGGGGCTCAGTTCTGCTGGCTGG - Intronic
1160513571 18:79466082-79466104 TGGGGAGCAGGGGTGCGGGGAGG + Intronic
1160517518 18:79486731-79486753 TGGGCTGCAGGGCTGCAGGCAGG - Exonic
1160607114 18:80059418-80059440 AGGCGCACAGTGCTGAGGGCTGG + Intronic
1160769213 19:822606-822628 CGGGGCGCGGGGCTGGGGGCTGG + Intergenic
1160773983 19:846419-846441 AGGGGAGGAGGGCGGCGGCCAGG + Intronic
1160810413 19:1010700-1010722 CGGGGCCCAGGGCGGGGGGCTGG + Exonic
1160843587 19:1157071-1157093 AGGGGCTGGGGGCTGCGGGAGGG - Intronic
1160907840 19:1460118-1460140 TGGGGCGCTGGGCAGCAGGCAGG + Intronic
1160945939 19:1644157-1644179 AGGGGCGGAGGGATCCCGGCAGG - Intronic
1160957119 19:1698877-1698899 AGGAGTGCCGGGCGGCGGGCGGG - Intergenic
1160966503 19:1749149-1749171 AGGGGCCCAGGCCTGCGAGACGG + Intergenic
1161022028 19:2015167-2015189 AGGGGTGCAGGGCTCGGGGATGG + Intronic
1161051705 19:2167395-2167417 AGGGCAGCAGGCATGCGGGCGGG - Intronic
1161114891 19:2491169-2491191 AGGCTAGCAGGGCTGGGGGCTGG + Intergenic
1161124126 19:2546420-2546442 TGGGGCCCAGGGCTGCGGGCGGG + Intronic
1161400914 19:4065968-4065990 AGGGGCGGTGAGCGGCGGGCCGG - Intronic
1161514453 19:4688985-4689007 AGGGGCAGAGGGATGGGGGCGGG - Intronic
1161959448 19:7515924-7515946 ATGGGGCCAGGGCTGCGTGCGGG + Intronic
1162016698 19:7850137-7850159 AGGAGAGCAGGGCTGCAGGAGGG + Intronic
1162087158 19:8255747-8255769 TGGGGTGCAGGGAAGCGGGCCGG + Intronic
1162430561 19:10625741-10625763 TGGGGCGCAGGGAAGGGGGCTGG + Intronic
1162727068 19:12696152-12696174 AGGTGCGCGGGGCCGGGGGCCGG - Exonic
1162935244 19:13978712-13978734 ACGGGCGGGGGGCAGCGGGCGGG - Intronic
1162949488 19:14062074-14062096 AGTGGGGGGGGGCTGCGGGCGGG + Intergenic
1162975520 19:14205726-14205748 CGGGGCGCGGGGGTGCGGACGGG - Intronic
1163021420 19:14482808-14482830 GGGGCCGCAGGGCTGGGGGAGGG + Exonic
1163183762 19:15622186-15622208 AAGGGAGCAGGGCTGGGGCCAGG - Intronic
1163414528 19:17178052-17178074 AGGTCGGCAGGGCTGCGGGTGGG + Intronic
1163664736 19:18598061-18598083 GGGGGCGCAGGGCGGGAGGCAGG - Intronic
1163688485 19:18725581-18725603 AGGGGCACCAGGCTGCCGGCTGG + Intronic
1164412959 19:28020946-28020968 AGGGGCCCAGGGCTGGCAGCTGG + Intergenic
1164517456 19:28948365-28948387 AGGGGCCCAGGGCTGGCGGCTGG + Intergenic
1164549410 19:29196347-29196369 AGGAGCGCAGGGTTGGGGGCAGG - Intergenic
1164825268 19:31280460-31280482 TGGGGGACAGGGCTGGGGGCTGG - Intronic
1165460899 19:35943821-35943843 AGCGGAGCTGGGCTGCAGGCTGG + Intronic
1165758859 19:38309159-38309181 GGGGGCTCAGGGGTGGGGGCAGG - Intronic
1165786164 19:38463283-38463305 TGGGGAGCAGGGCTGCTGGATGG + Intronic
1166373882 19:42316306-42316328 TGGGGAGCAGGGTTGGGGGCTGG + Intronic
1166759489 19:45215802-45215824 GGGGGCGCAGGGCTGCCTGGAGG - Intronic
1166898133 19:46036709-46036731 AGGGCCTCATGGCTGGGGGCTGG + Intergenic
1166990408 19:46689504-46689526 AGGGGCGGGTGGCAGCGGGCAGG + Intronic
1167074997 19:47243239-47243261 CGGGGCTCCGGGCTGGGGGCTGG + Intergenic
1167080813 19:47275113-47275135 CGGCGCGCTGGGCTGTGGGCCGG - Exonic
1167114278 19:47479984-47480006 ATGGTTTCAGGGCTGCGGGCGGG - Intronic
1167295212 19:48645656-48645678 AGGGGGGCAGGGCGTTGGGCAGG - Exonic
1167315030 19:48757844-48757866 AGGGAGGCAGGGCTGGGGCCTGG + Intronic
1167586076 19:50376763-50376785 CGGGGCTCATGGCTGCGCGCGGG - Exonic
1167622660 19:50568052-50568074 CGGGGGGCGGGGCTGCGGCCGGG + Intergenic
1168144983 19:54415700-54415722 TGGGGGCCAGGGCTGGGGGCCGG + Intronic
1168512845 19:56987302-56987324 AGGGGCGAGGGCCTGCAGGCTGG + Intergenic
925046559 2:777287-777309 CGGGGAGCAGGGCTGCGGGCTGG - Intergenic
925313779 2:2906725-2906747 AGGGGTGGGTGGCTGCGGGCTGG - Intergenic
925997333 2:9304106-9304128 AGGGACCCAGGGCTCAGGGCGGG - Intronic
926066405 2:9843678-9843700 CGGGGCGGAGGGCTGCAGGGCGG + Intronic
926077256 2:9951513-9951535 AGCGGCGCGGGGCGGGGGGCGGG - Intergenic
927038382 2:19204009-19204031 AGGGGAGCAGGGCTATGGGTGGG - Intergenic
927512913 2:23655644-23655666 AGGGGCTAATGGCTGAGGGCTGG - Intronic
927846365 2:26474439-26474461 TGGGGCCTAGGGCTGGGGGCTGG - Intronic
927884408 2:26709809-26709831 ATGGGCGCAGGGCTACTGCCAGG + Intronic
927904987 2:26849226-26849248 AGGGGAGGAGGGATGCAGGCGGG + Intronic
927935001 2:27071475-27071497 AGAGGGGCTGAGCTGCGGGCTGG + Intronic
932278899 2:70472629-70472651 AGGGGAGCAGGGCTGTTGGGAGG - Intronic
933157623 2:78992971-78992993 AGGTGTGGAGGGCTGCGGGGCGG - Intergenic
933728176 2:85437971-85437993 GGGGGCGGGGGGCTGGGGGCGGG + Intergenic
934059743 2:88283088-88283110 AGGGGCACTGGCCTGAGGGCTGG - Intergenic
934689875 2:96350404-96350426 AGGGGTGCAGGGCTCCAGGTGGG + Intronic
935112290 2:100104735-100104757 GCGGGCGCAGGGCCGGGGGCGGG - Intronic
936122662 2:109760356-109760378 GGCGGCGCAGGGCCGGGGGCGGG + Intergenic
936222031 2:110611117-110611139 GGCGGCGCAGGGCCGGGGGCGGG - Intergenic
936966773 2:118134708-118134730 AGGGGCCCATGTCTGCGGGAGGG + Intergenic
937240756 2:120460931-120460953 AGGGGTGCTGGGCTGAAGGCTGG - Intergenic
938407339 2:131039887-131039909 CGGGGCGCAGGGCTGAGGACTGG - Intronic
938765912 2:134460336-134460358 AGGGGCTGAGGGCTGAGGACAGG - Intronic
940472792 2:154120345-154120367 AGTTGGGCAGGGCTGCAGGCTGG + Intronic
942108265 2:172655126-172655148 ACGTGGGCAGGGCTGCAGGCTGG - Intergenic
942453897 2:176124738-176124760 AGGAGCCCAGGGCCTCGGGCGGG + Exonic
944414271 2:199467535-199467557 AGGGGAAGAGGGCTGAGGGCGGG + Intronic
945119550 2:206443706-206443728 CGGGGCGCGGGGCTCGGGGCTGG - Exonic
946322785 2:218963225-218963247 AAGGGCGCTGGGCTGAGGCCAGG - Intergenic
947549725 2:231037640-231037662 AGCGGCGGGGGGCCGCGGGCAGG + Exonic
947731120 2:232432282-232432304 AAGGGAGCAGGGCTGAGGCCAGG + Intergenic
947865868 2:233397468-233397490 AGGGGAGCAGGGTGGCTGGCGGG + Intronic
948229802 2:236341645-236341667 AGGGCCGCAGGGATGCGGTGTGG + Intronic
948479505 2:238240816-238240838 AGGGGAGGAGGGAGGCGGGCGGG - Intergenic
948716205 2:239865273-239865295 TGGGGCTCAGGGCTGCGCCCTGG - Intergenic
1168913284 20:1466942-1466964 CGTGGGGCGGGGCTGCGGGCGGG - Intronic
1170907926 20:20532756-20532778 AGTGACGCAGGGCTTAGGGCTGG - Intronic
1170948251 20:20911365-20911387 AGGGCCACAGGTCTTCGGGCTGG - Intergenic
1170999284 20:21396877-21396899 AGGGGCGCGGGGGCGCGGGACGG - Intronic
1171278835 20:23879965-23879987 AGAGGGGCAGGGCTGTGGGGAGG - Intergenic
1171462198 20:25304422-25304444 AGGGGCACAGCTCTGAGGGCAGG - Intronic
1172020381 20:31909681-31909703 AGGGGAGCGGGGCTGTGAGCAGG + Intronic
1172149614 20:32780629-32780651 GGAGGCCAAGGGCTGCGGGCAGG - Intronic
1172273437 20:33667260-33667282 CGGAGCGCCGGGCTGCGAGCTGG + Exonic
1172421882 20:34825244-34825266 CGGGCCCCAGGCCTGCGGGCGGG - Intronic
1172604740 20:36206906-36206928 AAGGGCGCAGGCCTGGGGGTCGG - Intronic
1172662040 20:36574426-36574448 CTGGGCGCAGGGCTGGGGGGGGG + Intronic
1172714280 20:36951392-36951414 AGGGGCGAAGGGCGGCGACCTGG - Intronic
1172766130 20:37351926-37351948 AGGGGTGCGGTGCTGGGGGCAGG + Intronic
1173154988 20:40601112-40601134 AGGGGAGGAGGGGTGAGGGCTGG + Intergenic
1173817758 20:46000688-46000710 AGAGCCCCAGGGCTGCAGGCTGG - Intergenic
1173822745 20:46029594-46029616 CCGGGGGCAGAGCTGCGGGCCGG + Intronic
1173827388 20:46056575-46056597 GGGGGCTAAGGGCTGGGGGCTGG + Intronic
1173847838 20:46199337-46199359 AGGGGCCAAGGGCTGGGGGCAGG - Intronic
1173973150 20:47167962-47167984 AGGAAAGCAGGGCTGCGAGCTGG - Intronic
1174576662 20:51542307-51542329 AGGGGCTCAGGCCTGGGGACTGG - Intronic
1174736718 20:52972217-52972239 AGGGGAGAGGGGCTGGGGGCGGG - Intergenic
1175014670 20:55776771-55776793 AGGGGAGTAGGGCTGGGGGAGGG - Intergenic
1175471639 20:59234101-59234123 AGGGGTGCAGTGCTGTTGGCAGG + Intronic
1175523679 20:59619018-59619040 AGTGGAGCAGGGATGCTGGCAGG + Intronic
1175828748 20:61950917-61950939 AGGGGCCCAGGGCTGTGGAAGGG - Intergenic
1175828833 20:61951122-61951144 GGGGGCCCAGGGCTGGGGGAGGG - Intergenic
1175926993 20:62475893-62475915 AGGGGCGCGCGGCTGCAGCCCGG + Intronic
1175941377 20:62539016-62539038 AGCGGGGCAGGGGTGGGGGCTGG - Intergenic
1175941393 20:62539053-62539075 AGCGGGGCAGGGGTGGGGGCTGG - Intergenic
1175941408 20:62539090-62539112 AGCGGGGCAGGGATGGGGGCTGG - Intergenic
1176138804 20:63536268-63536290 AGGGGTGCAGGGGTGGGGTCTGG - Intronic
1176200684 20:63858934-63858956 AGGGGCAGAGGTCAGCGGGCTGG - Intergenic
1176306869 21:5128246-5128268 AGAGGTGAAGGGCTGCGCGCTGG + Exonic
1179411788 21:41168163-41168185 CGGCGCGCGGGGCTGCGGGCAGG - Exonic
1179492828 21:41752435-41752457 AGGGGGGAAGGCCTGCGAGCAGG + Intronic
1179511826 21:41878825-41878847 GGGGCCGCGGGGCCGCGGGCCGG + Exonic
1179626818 21:42653721-42653743 AGGGGAGCAGGGGAGGGGGCGGG - Intronic
1179850188 21:44133784-44133806 AGAGGTGAAGGGCTGCGCGCTGG - Exonic
1180086176 21:45508934-45508956 TGGGGTGCAGGCCTGGGGGCTGG + Intronic
1180180299 21:46115951-46115973 TGGGGCGCTGGGCTGCAGGCGGG - Intronic
1180226767 21:46398096-46398118 AGGGCCCCAGGGCTGCGGCTTGG - Exonic
1180230585 21:46424674-46424696 GGGGGAGCAGGGCGGCGGGCAGG - Intronic
1180594590 22:16964898-16964920 TGGGGCTCAGGGCTGCTGTCAGG + Intronic
1180755121 22:18155765-18155787 AGGAGCCCATGGCTGCGGGGTGG - Intronic
1180794392 22:18594983-18595005 AGGGGAGCAGGGCTGCCAGAGGG + Intergenic
1180979267 22:19871173-19871195 AGGAGCTCAGGGTTGGGGGCAGG - Intergenic
1181227348 22:21400337-21400359 AGGGGAGCAGGGCTGCCAGAGGG - Intergenic
1181251302 22:21534502-21534524 AGGGGAGCAGGGCTGCCAGAGGG + Intergenic
1181511272 22:23389775-23389797 CGGGCTGCAGGGCTGCGGTCTGG - Intergenic
1181511286 22:23389828-23389850 CGGGCTGCAGGGCTGCGGTCTGG - Intergenic
1181511299 22:23389881-23389903 CGGGCTGCAGGGCTGCGGTCTGG - Intergenic
1181745461 22:24952716-24952738 AGGTGCCGCGGGCTGCGGGCAGG + Intronic
1182554230 22:31120343-31120365 TGGGGCTCAGGGCGGCAGGCTGG - Intergenic
1183228289 22:36564890-36564912 CGGGGCGCAGGGTGGCGGGGTGG + Intronic
1183526442 22:38325990-38326012 AGGCTGGCAGGGCTGGGGGCGGG - Intronic
1183591647 22:38782626-38782648 AGGGAGGCAGGACTGCCGGCAGG - Intronic
1183605968 22:38866864-38866886 GGGGGCGCCGGGCAGGGGGCCGG - Exonic
1183629703 22:39025753-39025775 AGGGGGGCAGGACGGAGGGCAGG - Intronic
1184233723 22:43171987-43172009 AGGGGTTCAGGGCTCAGGGCAGG + Intronic
1184236864 22:43187348-43187370 AGGGGCGGGGGGCTGGGGGGAGG - Intergenic
1184315925 22:43689210-43689232 GGGGGCGCAGGGCCGGAGGCAGG + Intronic
1184610870 22:45602291-45602313 AGGGAAGCAGGGCTGGGAGCTGG + Intergenic
1184677905 22:46053650-46053672 AGGGGCTGGGGGCTGGGGGCCGG + Intronic
1185101674 22:48843925-48843947 TGGGGTGCAGGGCTGTGGGCTGG - Intronic
1185146712 22:49141141-49141163 AGGGGGTCAGGGCTGAGGGGTGG + Intergenic
1185238407 22:49727705-49727727 ATGGCCGATGGGCTGCGGGCAGG - Intergenic
1185280164 22:49966547-49966569 AGAGGCTCAGGGCGGTGGGCTGG - Intergenic
1185342912 22:50299646-50299668 ACGGGCGCGGCGCTGCGGGAAGG - Intronic
1185373865 22:50473256-50473278 AGGGGCCTTGGGCTGAGGGCTGG - Intronic
1185374190 22:50474672-50474694 GGGGGCCGAGGGCTGGGGGCTGG - Intronic
1185420158 22:50730646-50730668 ACGGGCGGAGGGGAGCGGGCAGG - Intergenic
950446309 3:13040841-13040863 AGAGGAGCAGGGCTGGGTGCGGG - Intronic
950510047 3:13420437-13420459 AGGGACGCGGGGCTGGGGGATGG + Intergenic
950680963 3:14584820-14584842 AGGGTCTATGGGCTGCGGGCAGG - Intergenic
952788251 3:37176590-37176612 CGGGGCCCTGGGCTGCTGGCGGG + Intronic
952964114 3:38610520-38610542 AGGGGCTGAGGGCTGTGGTCAGG + Intronic
953326065 3:42013550-42013572 GGCGGCGCGGGGCGGCGGGCGGG + Intergenic
954244020 3:49316738-49316760 AGAGGCCCAGGGCAGGGGGCAGG - Intronic
954625417 3:52019643-52019665 AGGGGCAGAGGGGTGGGGGCTGG + Intergenic
954685842 3:52369745-52369767 AGGGCTGCAGGGCTGCGGGGAGG - Intronic
956718775 3:72100329-72100351 AGGTGAGCAGGGCTGGGGGCTGG + Intergenic
958447671 3:94235305-94235327 GGGGGCGGGGGGCTGGGGGCTGG - Intergenic
959539498 3:107523541-107523563 ACGGGCGCCGGGGCGCGGGCTGG + Intronic
960146653 3:114210898-114210920 AGGGGTGGAGGGCTGGGGGAGGG + Intergenic
960986490 3:123284495-123284517 AGCAGCGCAGCCCTGCGGGCTGG + Exonic
961370043 3:126423426-126423448 AGAGGGGCAGGGGTGGGGGCAGG - Intronic
961379481 3:126487752-126487774 AGGGCAGCTGGGCTGGGGGCAGG - Intronic
961552571 3:127677593-127677615 GGGGGCTCAGGGCAACGGGCTGG - Intronic
961810575 3:129519378-129519400 AAGGGCGCAGGTCTGTGGACAGG + Intronic
962475567 3:135752223-135752245 AGGGGAGGAGGACTGTGGGCGGG - Intergenic
963044809 3:141094763-141094785 AGGGGCGGGGGGCGGGGGGCGGG - Intronic
963598347 3:147356407-147356429 AGGGGCCCAGATCTGGGGGCTGG - Intergenic
965561293 3:170064374-170064396 AGGCGCCCAGGTGTGCGGGCAGG + Intronic
966855694 3:184192696-184192718 ATGGGGGCAGGGGTGCGGGTGGG - Intronic
967055412 3:185825367-185825389 AGGGGCGCAGCGGCGCGGGGCGG - Intergenic
967893480 3:194379639-194379661 AGGGGGACAGGGCTGGGTGCAGG + Intergenic
967903920 3:194486246-194486268 AGAGGCGTAGGGGTGCTGGCAGG - Intronic
968230642 3:197003019-197003041 GGGGGCGCGGGGCTGCGGGGAGG + Exonic
968434174 4:576369-576391 AGGCGCGCGGGGCCGCGGGCGGG - Intergenic
968594159 4:1473818-1473840 AGCAGTGCAGGGCTCCGGGCGGG + Intergenic
968596164 4:1486812-1486834 AGGAGAGCAGGGCTGTGGGAGGG - Intergenic
968613897 4:1568806-1568828 AGCGCCGCGGGGCTGCGGGTCGG - Intergenic
968660036 4:1795056-1795078 AGGGGCGCGGGGGCGCGGGCGGG - Intronic
968701508 4:2060053-2060075 ATGGGCGCAGGGCCCCGAGCGGG + Intronic
968765818 4:2468649-2468671 AGGGGCGCGGAACGGCGGGCGGG + Intronic
968817593 4:2829814-2829836 AGGGGTCCAGGGCTCCGGGCTGG - Exonic
968976026 4:3822420-3822442 AGGGGAGGCAGGCTGCGGGCCGG - Intergenic
969134609 4:5019940-5019962 AGGGATGCAGAGCTGCGGTCAGG + Intergenic
969240334 4:5893008-5893030 CGGTGCCCAGGGCCGCGGGCGGG - Exonic
969453601 4:7288545-7288567 AGGGGCGGGGGGCGGGGGGCGGG + Intronic
969483330 4:7458344-7458366 AGCGGAGCAGGGCTGGGTGCAGG + Intronic
969491414 4:7501193-7501215 ACGGGAGCAGGGCTGTGGGGCGG - Intronic
969589526 4:8113906-8113928 AGGGGCACAGGGCTGTGTGCAGG + Intronic
969619533 4:8272134-8272156 AGGGCTGCAGGGCTCAGGGCTGG + Intronic
969652958 4:8478487-8478509 AGGGGCACAGTGCTGCTGGGGGG - Intronic
969705594 4:8789489-8789511 AGAGGCGGAGGCCTGCAGGCGGG + Intergenic
969716846 4:8871903-8871925 AGGGGCGGGGGGTCGCGGGCTGG + Intergenic
971195006 4:24464815-24464837 AGGGGAGGAGGGAAGCGGGCAGG - Intergenic
975139165 4:70902602-70902624 ACGGGCGGCGGGCGGCGGGCGGG - Intronic
975909384 4:79249092-79249114 AGGGGCCCAGGGCTCCGCTCAGG - Intronic
976207675 4:82638266-82638288 GGGGGGGCAGGGCAGGGGGCGGG - Intronic
976765323 4:88592573-88592595 AGGTGCGCAGGGCGGGGGCCGGG + Exonic
977908307 4:102501713-102501735 AGCGGCGCGGGCCTGCCGGCTGG - Exonic
978154452 4:105473648-105473670 AGAGGCGCAGGGCTGCCGGCTGG - Intronic
978348903 4:107800695-107800717 AGGGGAACAGGACTGTGGGCTGG - Intergenic
978546979 4:109880484-109880506 AGCTGGGCAGGGCTGCAGGCTGG - Intergenic
978620459 4:110631399-110631421 AGGGGCCGAGGGCTGTGGGGGGG + Intronic
981871415 4:149491413-149491435 AGGGGCTGAGGGTTGCGGGTTGG - Intergenic
981938580 4:150258345-150258367 AGGTGCGGTGGGTTGCGGGCTGG + Intergenic
982245214 4:153344516-153344538 AGGGGCGCGGGCCTGGGGCCGGG - Intergenic
984928283 4:184825727-184825749 AGGGAAGCGGGGCCGCGGGCAGG + Intronic
985129026 4:186723631-186723653 TGGGGCGCGGGCCGGCGGGCGGG - Intronic
985621643 5:959270-959292 TGGGGGGCAGGGCTGGGGGTGGG - Intergenic
985713866 5:1445267-1445289 TGGGGCGCAGGGGCGGGGGCCGG - Intronic
985714238 5:1446519-1446541 TGGGGCACCGCGCTGCGGGCGGG - Intergenic
985778721 5:1858572-1858594 AGGGGCGCGGGGCCCAGGGCCGG + Intergenic
987327991 5:16829630-16829652 AGCGCCGCAGGGCTGCAGGCAGG + Intronic
988988635 5:36646923-36646945 AGGGAAGCAGAGCTGCTGGCAGG + Intronic
990252056 5:53926241-53926263 AGGGCTGCAGAGATGCGGGCAGG + Intronic
992169706 5:74089597-74089619 AGGGAGGCAGGGCTGGGAGCAGG - Intergenic
995052730 5:107724759-107724781 CGGGGGCCGGGGCTGCGGGCAGG - Intergenic
995735605 5:115296719-115296741 AGGGGTGCGGGGGTGCGGGAGGG + Exonic
997296657 5:132772904-132772926 AGGGGCCCATGTCTGCTGGCAGG - Intronic
997652738 5:135534767-135534789 AGGGGCGCTGGGCTGAGGGCCGG + Exonic
997870180 5:137499253-137499275 AGGAGCGCAGGGGCGCGAGCCGG - Exonic
998658117 5:144205195-144205217 AGGCGCGCGGGGCTTGGGGCGGG - Intronic
999255349 5:150206893-150206915 AGGGCAGCAGGGCAGCGGGGCGG - Intronic
999330651 5:150671692-150671714 AGGGGAGCGCGGCTGGGGGCGGG + Intronic
999381528 5:151124594-151124616 AGGGACTCAGGGCTGGGAGCAGG + Intronic
999584958 5:153080172-153080194 GGGGGTGGAGGGCTGCGGGTGGG - Intergenic
1001494712 5:172179583-172179605 AGACCCGCAGGGCTGTGGGCAGG + Intronic
1001518041 5:172370547-172370569 AGTGGCACAGGGCTCAGGGCTGG + Intronic
1001608832 5:172983720-172983742 AGGGGCGGAGGCCGGCGCGCGGG + Intergenic
1002029281 5:176416203-176416225 GGGGCCGCATGGCTGCCGGCAGG + Exonic
1006230681 6:32584088-32584110 AGGTGAGCATGGCCGCGGGCGGG - Exonic
1006516193 6:34546995-34547017 AGGGGTGGGGGGCTGCGGGGGGG - Intronic
1006614730 6:35318525-35318547 AGGGGCGGAGCGCCGGGGGCGGG + Intronic
1006799130 6:36748302-36748324 AGGGAGGCAGGGCTGTGGGAGGG + Intronic
1006950968 6:37820289-37820311 AGGGGGGCAGGGCGGCGGGGAGG + Intronic
1007228219 6:40329475-40329497 AGGAGGGCAGGGCTGCAGGAGGG - Intergenic
1007341495 6:41193954-41193976 AGGGTTGCAGGGATGAGGGCAGG - Intronic
1008013445 6:46491641-46491663 GGGGGTGCGGGGCTGAGGGCAGG - Intronic
1008276583 6:49550517-49550539 AAGGGAGCAGGGCTCCGGACAGG + Intergenic
1010001872 6:70956637-70956659 AGGGGTGCAGGCGGGCGGGCAGG + Exonic
1011411961 6:87075299-87075321 AGGGGTTCAGTGCTGTGGGCTGG - Intergenic
1012410125 6:98947639-98947661 GGGGGCGCGGGGCCGCGGGCGGG + Intronic
1012450719 6:99350020-99350042 GGCGGCGCGGAGCTGCGGGCAGG + Intronic
1013497205 6:110709356-110709378 AGGGGTGGAGGGCTGGGGGAGGG + Intronic
1014778213 6:125534204-125534226 AGGCAGGCGGGGCTGCGGGCTGG + Intergenic
1014799238 6:125759361-125759383 GCTGGAGCAGGGCTGCGGGCAGG - Exonic
1015548492 6:134386850-134386872 CGGGGTGGAGGGCTGCGGGAGGG + Intergenic
1016400859 6:143678245-143678267 GCGGGCGCAGGGCTGGCGGCGGG + Intronic
1017746059 6:157447603-157447625 AGGAAGGCAGGGCTGCAGGCAGG + Intronic
1017914197 6:158819133-158819155 AAGGTCGCGGGGCCGCGGGCCGG + Intronic
1018380278 6:163252541-163252563 AGAGGGGCAGTGCTGCAGGCGGG + Intronic
1018447876 6:163874758-163874780 AGGGGCACAGGGCTGCAGGAGGG - Intergenic
1018669935 6:166169247-166169269 AGGGGCGAGGGGCAGGGGGCAGG - Intergenic
1018727779 6:166627084-166627106 CGGGGCTCAGGTCCGCGGGCGGG + Intronic
1018765899 6:166932447-166932469 AGTGGAGCAGAGCTGGGGGCTGG - Intronic
1018876519 6:167826849-167826871 CGGCGCGCACGGCGGCGGGCGGG + Intergenic
1018876643 6:167827271-167827293 CGGGGCGCGGCGCAGCGGGCGGG - Intronic
1019112000 6:169724176-169724198 GAGGGCGCGGGGCTGCGGGCCGG + Intronic
1019299672 7:296784-296806 CGGGACGCAGGGCTGCGGGGTGG + Intergenic
1019299853 7:297394-297416 TGGGACGCAGGGCTGAGGGGTGG + Intergenic
1019345997 7:531186-531208 AGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1019473397 7:1232966-1232988 CGGGGCGCGGGGGCGCGGGCCGG - Exonic
1019476657 7:1247652-1247674 GGGGGCGCTGTGCTGGGGGCGGG - Intergenic
1019480553 7:1264783-1264805 AGGGGCGCAAGGCTGCAGGCAGG - Intergenic
1019707563 7:2503799-2503821 AGGAAGGCAGGGCTGGGGGCTGG - Intergenic
1019729703 7:2623242-2623264 AGGGGCGCAGGGCTCTGGAGAGG - Intergenic
1019775399 7:2909494-2909516 AGGGGCGCAGGGGTGAGGGGCGG - Intronic
1020220501 7:6232944-6232966 AGGGGCAGAGGGCTGCAGGGAGG - Intronic
1021450242 7:20777928-20777950 GATGGCGCAGGGCAGCGGGCTGG + Intergenic
1021452743 7:20797964-20797986 AGGTGCGCAGAGGCGCGGGCTGG - Intergenic
1022097519 7:27150325-27150347 AGGGGGGCAGGACGGCGAGCTGG + Intronic
1024066113 7:45738053-45738075 AGGGGTGGAGGGCTGGGGGAAGG + Intergenic
1024299293 7:47874333-47874355 AGGGGTGCAGGGCTGTGGTGAGG + Intronic
1025730042 7:64100590-64100612 AGGGGCGCAGGCTTGGGGGACGG + Intronic
1026968253 7:74453754-74453776 AGGGGCGCGGGGCGCGGGGCGGG + Intergenic
1026984434 7:74546076-74546098 GAGGGCGGAGGGCTGAGGGCTGG - Intronic
1029436651 7:100567572-100567594 ATGGGAGCAGGGCTGAGGGTAGG + Exonic
1029600036 7:101558105-101558127 AGGCAGGCAGGGCTGCGGGGAGG + Exonic
1033608798 7:142946167-142946189 AGGGGTGGAGGGATGTGGGCTGG + Intronic
1033610264 7:142958061-142958083 AAGGGCGCAGGGCAGAGGTCAGG - Intronic
1034617900 7:152435460-152435482 AGGGGCGCGGGGCCGGGGCCGGG + Intronic
1034686350 7:152974670-152974692 TGGGGTGCAGGGCTGCGTGCAGG - Intergenic
1035020808 7:155799098-155799120 AGGGGCTGGGGGCTGAGGGCAGG - Intergenic
1035203247 7:157279703-157279725 GGGCCCGGAGGGCTGCGGGCTGG - Intergenic
1035289028 7:157825325-157825347 AGCAGCTCAGGGCTGAGGGCTGG + Intronic
1035555482 8:564347-564369 GCGGGCGCAGAGCTACGGGCAGG + Intergenic
1035705229 8:1669964-1669986 CGAGGCCCAGGGCTGCAGGCAGG - Intronic
1036282756 8:7415744-7415766 AGGGAGGCAGGGAGGCGGGCAGG - Intronic
1036701514 8:11016425-11016447 AGTAGCGCAGGTCTGGGGGCGGG + Intronic
1037911044 8:22743760-22743782 AGGGGCGTGGTGCTGCCGGCAGG - Intronic
1037911763 8:22747899-22747921 AGGAGCCCAGGGCCGCGTGCAGG + Intronic
1038472648 8:27838312-27838334 AGGGGCCCAGAGCTCAGGGCAGG + Intergenic
1038575564 8:28701334-28701356 AGGGGCGCGGGGCCGGGCGCCGG - Exonic
1038650815 8:29401764-29401786 GGGGGCGGGGGGCGGCGGGCGGG - Intergenic
1039560174 8:38506107-38506129 AGAGGTGCAGGGCTGTGGTCAGG + Intergenic
1039964100 8:42271439-42271461 AGGGACGCGGGGCAGGGGGCGGG - Exonic
1040295947 8:46149159-46149181 GGGGCCGCAGGGCTGCAGGGTGG - Intergenic
1040572770 8:48624850-48624872 AGGGCAGCAGGGCTGAGGGGAGG - Intergenic
1042007056 8:64192845-64192867 AGGGGCACAGGCCTGGAGGCAGG - Intergenic
1043463745 8:80486123-80486145 AGGGGGGCTGGGCTTGGGGCTGG - Intronic
1044874960 8:96656438-96656460 AGTTGAGCAGGGCTGCAGGCTGG + Intronic
1046086259 8:109439379-109439401 AGGGGCTCAGTGTTGCTGGCTGG + Intronic
1049438705 8:142599442-142599464 AGGGGCGCAGGTTTGTTGGCCGG - Intergenic
1049479888 8:142816926-142816948 AGAGGTGCAGGGCTGAGGCCGGG - Intergenic
1049572280 8:143374896-143374918 AGGGCCGCGGGGCTGCAGTCTGG + Intronic
1049575953 8:143389738-143389760 AGGGGCTCTGGGCACCGGGCAGG - Intergenic
1049709544 8:144057397-144057419 CAGGGAGCAGGGCTGGGGGCAGG + Intronic
1049733519 8:144191470-144191492 AGAGGCCCAGTGCTGCTGGCGGG + Intronic
1049807690 8:144548309-144548331 CGGGGCGAAGGTCTGCAGGCTGG + Exonic
1051665642 9:19464968-19464990 CGGGGCGCAGGGCTGCGGCGGGG + Intergenic
1052974439 9:34400856-34400878 AGGGGCGCGGGGCCGGGGGCAGG + Exonic
1055478961 9:76691133-76691155 AGGGGCGCAGGGCAGCCATCTGG + Intronic
1056102437 9:83312746-83312768 CGGGGCGCAGGGCGGCGGAGGGG - Intronic
1056739954 9:89245957-89245979 AGAGGAGCAGGGCTGTGGCCTGG + Intergenic
1056780370 9:89544575-89544597 AAGGGGGCAGGGCTGGGGGCAGG - Intergenic
1056801340 9:89694143-89694165 AAGGGCACAGGGCTGCTGACGGG + Intergenic
1056992581 9:91424505-91424527 AGCTGCGCAGGGCTGCGCGGCGG + Intergenic
1057054371 9:91949687-91949709 AGGGGGTCCGGGGTGCGGGCCGG + Intronic
1057192454 9:93095521-93095543 AGACGGGCAGGGCTCCGGGCAGG + Intergenic
1057268434 9:93633822-93633844 AGGGGCCCAGCACTGCTGGCAGG - Intronic
1059392399 9:114007498-114007520 AGGCGGGGAGGGCTGGGGGCTGG - Intronic
1059633891 9:116154214-116154236 CGCCGCGCTGGGCTGCGGGCTGG + Exonic
1059965998 9:119614406-119614428 AGGGGCACAGGACTGGAGGCAGG + Intergenic
1060478055 9:124000006-124000028 AGGGGCGCCGGGGCCCGGGCCGG - Intergenic
1060816594 9:126638429-126638451 AGGGTGGCAGGGCTGCGGGCAGG - Intronic
1060945864 9:127569083-127569105 CGGGGTGCAGGGCCGAGGGCAGG - Exonic
1060945896 9:127569160-127569182 GCGGGCGCAGGGCAGCGGGCGGG - Intronic
1061036884 9:128118989-128119011 AGGGGTGCAGGGATGGGGGACGG + Intergenic
1061388788 9:130305876-130305898 AGGAGCACAGGGCTCCGGGTTGG + Intronic
1061480912 9:130897373-130897395 AGGGGCACAGGGGCGCGTGCAGG - Intergenic
1061892191 9:133628570-133628592 AGGTGCCCAGGGCTGGGGGAGGG + Intergenic
1062015121 9:134287549-134287571 AGGGGTGCTGGGGTGGGGGCGGG - Intergenic
1062049195 9:134438456-134438478 AGGGGTGGAGGGCGGCGGGGAGG - Intronic
1062069194 9:134546328-134546350 TGGGACGCAGGGCAGTGGGCAGG - Intergenic
1062084645 9:134642309-134642331 CGGGGCGCGGGGCTGCGGGATGG + Intronic
1062186215 9:135220015-135220037 AGGGGCGCTGGGGTGCCGCCAGG - Intergenic
1062231922 9:135486645-135486667 GGGAGCCCAGGGCTGCGTGCAGG + Exonic
1062239133 9:135526477-135526499 GGGGGCGCAGGGCAGGGGGAAGG - Exonic
1062305854 9:135906965-135906987 AGGGGCGCGGGGCGGGGGCCAGG - Intronic
1062421198 9:136483464-136483486 AGGGGGGCGGGGCCACGGGCGGG - Intronic
1062453953 9:136627109-136627131 AGGTGGGCAGGGCAGGGGGCTGG - Intergenic
1062483508 9:136763219-136763241 GGGGGCGGAGGGGTGAGGGCGGG + Intronic
1062566129 9:137164758-137164780 AGGGGCCGAGGGCTGGAGGCAGG - Intronic
1062600339 9:137316349-137316371 AGGGTCGCAGGGGTGTGTGCAGG + Intronic
1062609804 9:137368834-137368856 TGGGGCGCAGGGCCCGGGGCGGG + Intronic
1062609830 9:137368894-137368916 GGGGCCCCAGGGCTGTGGGCAGG + Intronic
1062609857 9:137368955-137368977 AGGGGCACAGGGCCGGGGGACGG + Intronic
1062609931 9:137369131-137369153 AGGGGCGCAGGGCCGGGGCGGGG + Intronic
1062609949 9:137369170-137369192 AGGGGCGCAGGGCCGGGGAGGGG + Intronic
1062656053 9:137605180-137605202 CGGGGGGCAGGGCTGGGGGCGGG - Intergenic
1062668587 9:137693132-137693154 AGGGGAGATGGGCTGAGGGCCGG + Intronic
1185462360 X:339274-339296 GGGGGGGCAGGGCTGCAGGGCGG + Intronic
1185837772 X:3361063-3361085 AGCGGCGGACGGCAGCGGGCCGG - Intergenic
1187526776 X:20061487-20061509 AGCAGGGCAGGGCTGAGGGCTGG - Intronic
1189398557 X:40645153-40645175 TGGGGCACAGGGTTGGGGGCAGG + Intronic
1189717718 X:43882532-43882554 TGGGCTGCAGAGCTGCGGGCGGG - Intergenic
1190333282 X:49248532-49248554 TGGGGCCCTGGGCTGTGGGCGGG + Intronic
1190758686 X:53422459-53422481 ACGTGCGCAGGGCCGCGGCCAGG + Intronic
1191184303 X:57592801-57592823 GGGGGCCCAGGGCGGCGGCCGGG - Exonic
1191213087 X:57909658-57909680 GGGGGCCCAGGGCGGCGGCCAGG + Exonic
1194977405 X:100408930-100408952 AGCCGCCCAGGGCTGCGGGTCGG + Exonic
1195625213 X:106999915-106999937 TGGCGCGCCGGGCTGCGGGCTGG - Exonic
1195668318 X:107449826-107449848 AGTGGCGCCGGGCGGCGGGGCGG - Intergenic
1195708717 X:107757365-107757387 AGGGAGGCAGGGCTGAGGCCAGG + Intronic
1196096184 X:111803006-111803028 AGGGGTGGAGGGCTGGGGGAGGG - Intronic
1199194805 X:145015907-145015929 CGGGGCGGAGGGGAGCGGGCAGG + Intergenic
1199432370 X:147776132-147776154 AGGGGTTCAGAGCTGTGGGCTGG - Intergenic
1200084082 X:153594420-153594442 AGGAGAGCAGGGCTGCGGCTGGG - Intronic
1200144756 X:153920858-153920880 AGGGGTAGAGGGCTGGGGGCTGG - Intronic
1200330510 X:155291928-155291950 ATGGCCGCGGGGCTGCGGGCGGG - Intronic
1201291219 Y:12421688-12421710 AGGCGCGCGGGCTTGCGGGCAGG - Intergenic