ID: 1099955736

View in Genome Browser
Species Human (GRCh38)
Location 12:89351584-89351606
Sequence GGCTAGGGGCGCAGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 435}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099955736_1099955748 3 Left 1099955736 12:89351584-89351606 CCCGCAGCCCTGCGCCCCTAGCC 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955736_1099955754 30 Left 1099955736 12:89351584-89351606 CCCGCAGCCCTGCGCCCCTAGCC 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1099955754 12:89351637-89351659 TACCTTCCAGGTAGAACGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 64
1099955736_1099955742 -8 Left 1099955736 12:89351584-89351606 CCCGCAGCCCTGCGCCCCTAGCC 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1099955742 12:89351599-89351621 CCCTAGCCCTGCCCCGCGCGCGG 0: 1
1: 1
2: 5
3: 30
4: 211
1099955736_1099955746 2 Left 1099955736 12:89351584-89351606 CCCGCAGCCCTGCGCCCCTAGCC 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1099955746 12:89351609-89351631 GCCCCGCGCGCGGAGTTCCCTGG 0: 1
1: 0
2: 2
3: 4
4: 82
1099955736_1099955751 18 Left 1099955736 12:89351584-89351606 CCCGCAGCCCTGCGCCCCTAGCC 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1099955751 12:89351625-89351647 TCCCTGGGCGCGTACCTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099955736 Original CRISPR GGCTAGGGGCGCAGGGCTGC GGG (reversed) Intronic
900205001 1:1427891-1427913 GGCTGGGCGCGCAGCGCTCCCGG + Intergenic
900341486 1:2191387-2191409 GGGCAGGGGAGCAGGGCTGCAGG + Intronic
900375106 1:2350646-2350668 GGCATGGGGGGCAGGGCTGGAGG + Intronic
900384900 1:2406023-2406045 GGCTGGGGGCGTAGGGCTCAGGG + Intronic
900415360 1:2532177-2532199 GGCTAGGGGCTCTGGACTCCCGG + Intergenic
900484836 1:2917516-2917538 GGCGAGGCGGGCAGGGGTGCAGG + Intergenic
900589133 1:3452045-3452067 GGCTGGGGGGGCCGGGCTGGTGG - Intergenic
900601741 1:3505687-3505709 GGGAAGGGGCGGTGGGCTGCAGG - Intronic
901007605 1:6179538-6179560 GGCCAGAGGCGCACGGCGGCGGG + Intronic
901514863 1:9738350-9738372 GGGGAGGGCTGCAGGGCTGCAGG - Intronic
901808172 1:11750662-11750684 GCCTAGGGATGCAGGGCTGGAGG + Exonic
902210077 1:14898661-14898683 GGTAAGGGGTGCAGGGCTGGAGG + Intronic
902700917 1:18171313-18171335 GGCTGGGGTCAGAGGGCTGCAGG + Intronic
903262031 1:22136608-22136630 GGCTGGGGGTACAGGGCTGCAGG + Intronic
903479891 1:23645358-23645380 GGGTAGAGGAGCAGGGCTGAGGG + Intergenic
904379318 1:30100637-30100659 GGATTGGAGCCCAGGGCTGCCGG + Intergenic
904424537 1:30414965-30414987 GGCCAGGGGTCCAGGGCAGCGGG - Intergenic
905179147 1:36156001-36156023 GGCTGCGGGCGCGGGGCTCCGGG + Intronic
905865591 1:41374642-41374664 GGCTTGGGTCTTAGGGCTGCTGG - Intronic
906004440 1:42456651-42456673 GGCTGGGCGCGCAGGGCCGGCGG + Exonic
906169032 1:43707974-43707996 GCCAAGGTGCGCAGCGCTGCGGG - Intronic
907118517 1:51989998-51990020 GGCAAGGGGCGCTGGGCAGCTGG - Intronic
908796093 1:67832934-67832956 GGCGCGGGGCGCACGGCCGCAGG + Intronic
912416068 1:109509192-109509214 GGCTGGGGTCACAGGGGTGCAGG + Intronic
912430009 1:109624044-109624066 GGCAAGGGGCACAGGGCTGCTGG + Intronic
912937913 1:114020156-114020178 GGCTAGGGCAGCTGGGATGCAGG - Intergenic
913112739 1:115671093-115671115 GGCTCCGGGCGCAAGGCTGTGGG - Intronic
914242021 1:145858774-145858796 GGCTCCGGGGGCGGGGCTGCGGG - Intronic
915164768 1:153942348-153942370 TGCTGGGGGTGCAGAGCTGCTGG - Exonic
915467008 1:156103867-156103889 GGGCAGGGGAGCAGGGCTGGTGG - Intronic
919577994 1:199336453-199336475 GGCTAGAGGCCCAGGCCTGGAGG + Intergenic
920179241 1:204122368-204122390 GGCTCGGGGGGCTGGACTGCAGG - Exonic
920191924 1:204199158-204199180 GGGTACGCCCGCAGGGCTGCAGG + Intronic
920642241 1:207763494-207763516 GATGAGGGGCGCAGGGCTGTGGG - Intronic
920786935 1:209050917-209050939 GGCTAGAGGCCCAGGCCTGGAGG - Intergenic
920924447 1:210328758-210328780 GGCTAGGGGCCCCGGGCCGCCGG + Intronic
922549306 1:226482390-226482412 GGCTGGGGAGGCAGGGCTGGTGG + Intergenic
922619499 1:226981280-226981302 GGCGTGTGGCCCAGGGCTGCTGG - Intronic
1064294724 10:14068202-14068224 GGCTGGGGGCGCAGGGGTTGGGG + Intronic
1066402548 10:35090143-35090165 GGGTCGGGGAGCCGGGCTGCAGG - Intronic
1067090722 10:43264750-43264772 GGGGAGGGGCGCTGGGCTGCTGG - Intronic
1067319609 10:45205526-45205548 GGCTTTGGGCCCTGGGCTGCAGG - Intergenic
1067830971 10:49610797-49610819 GGCTGTGGGCGCGGCGCTGCAGG + Exonic
1069557349 10:69406956-69406978 GGCTGGGGGCACAGGGCCACAGG + Intronic
1069695514 10:70382635-70382657 GGCGGGGCGCGCGGGGCTGCGGG + Intronic
1069784824 10:70981307-70981329 GGCTGGGGAGGCAGGGATGCTGG - Intergenic
1069931967 10:71889068-71889090 GGAGAGGCGCGCAGGTCTGCTGG + Intergenic
1070610031 10:77926663-77926685 GGCTGGGGGCCCGGGGCGGCGGG + Intergenic
1070858664 10:79630184-79630206 GGGTAGGGGCACAGAGCTGGGGG + Intergenic
1072971318 10:100020160-100020182 GGGTGGGGGCGAAGGGGTGCAGG + Intergenic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1074316997 10:112369881-112369903 GGCCAGCGGGGCAGGCCTGCTGG - Intergenic
1075402731 10:122172721-122172743 GTCCTGGGGCGCAGGGCTGCTGG + Intronic
1076119080 10:127921593-127921615 GGCTGGGGGCACAGAGCTGGGGG + Intronic
1076605495 10:131686871-131686893 GGCTGGAGGTGGAGGGCTGCCGG - Intergenic
1076629604 10:131844266-131844288 GACTTGGGGCTCAGGACTGCTGG - Intergenic
1076652515 10:131999560-131999582 GGCTAGAAGCGCAGGGCTCTTGG - Intergenic
1076704435 10:132293565-132293587 GGCCAGGGGAGCAAGGCAGCCGG + Intronic
1076785688 10:132748833-132748855 GGCTGGGGCAGCAGTGCTGCAGG - Intronic
1076806920 10:132863333-132863355 TGCTGGGGCCGCAGGGCTGGAGG - Intronic
1076846771 10:133073106-133073128 AGCTGGGTGCCCAGGGCTGCTGG + Intronic
1076853684 10:133105044-133105066 GGCTGGGGATGCAGGGCCGCTGG - Intronic
1076881754 10:133242735-133242757 GACTGGGGGCGCAGGGCGGCGGG + Intergenic
1077321795 11:1946180-1946202 GGCAGGGGGCCCAGGCCTGCAGG - Intergenic
1077481854 11:2818694-2818716 GGCTGGGGGCTCTGGGCAGCTGG - Intronic
1077497381 11:2892686-2892708 GGCAGAGGGCGCCGGGCTGCCGG - Intronic
1080457147 11:32428101-32428123 GGCTCGGGGTGCGAGGCTGCGGG + Intronic
1080540089 11:33257285-33257307 GGCTGGGCGCGCAGCGCTGCCGG + Intronic
1080606824 11:33870476-33870498 GGCTGCGGGCTCCGGGCTGCGGG + Intronic
1081621190 11:44620030-44620052 GCCTAGGGGAGCTGGGCTGGAGG + Exonic
1081695772 11:45108269-45108291 GGCCAGGGCAGCAGGGCAGCGGG - Intronic
1082976351 11:59076650-59076672 GCCTAGGGTCCCAGGGCTGGAGG + Intergenic
1083667880 11:64285375-64285397 GGCCAGGTGAGCAGGGCCGCGGG + Intronic
1083800574 11:65044260-65044282 GGGCAGGCGCGCAGGGCAGCAGG - Exonic
1083861648 11:65423216-65423238 GGCAGTGGGTGCAGGGCTGCAGG + Intergenic
1084032847 11:66491392-66491414 GGCTGGGGGCTGAGGGGTGCGGG + Intronic
1084128795 11:67118525-67118547 GGGAAGGGGCGCATGGCCGCCGG - Intergenic
1084152816 11:67299133-67299155 GGCTAGGGGTGGGGGGCTGGGGG + Intronic
1084268988 11:68019250-68019272 GACCAGGTGAGCAGGGCTGCCGG + Exonic
1084558827 11:69891363-69891385 GGCCATGGGTGCAGGGCTGGAGG - Intergenic
1084576009 11:69988352-69988374 GGCCGAGGGCACAGGGCTGCAGG - Intergenic
1084689464 11:70716611-70716633 GGCCAGGGGCGGAGGGCGGGTGG - Intronic
1084761206 11:71272290-71272312 GGAGAGGGGAGCAGTGCTGCAGG + Intergenic
1085299672 11:75450751-75450773 GGCTAGGGGCGAGGGGCTGGGGG - Intronic
1085384870 11:76151819-76151841 GGCAAAGGCCCCAGGGCTGCAGG - Intergenic
1085476927 11:76794804-76794826 GGCTAGGGGGACAGGGCAGGTGG + Intronic
1086411857 11:86551788-86551810 GGCTCAGGGCCAAGGGCTGCTGG + Intronic
1088713509 11:112528806-112528828 GGCTAGGGGCGAGGGGCAGGGGG - Intergenic
1089713517 11:120335750-120335772 AGCCGGAGGCGCAGGGCTGCGGG - Intergenic
1090392532 11:126398420-126398442 GGCCAGGGAAGCAGGGCTGCCGG - Intronic
1090832128 11:130427338-130427360 GGGTGGGGGCGCAGGGATCCAGG + Intronic
1091220194 11:133926076-133926098 GGCCCGGGGCCCAGGGCTTCAGG + Intronic
1202804812 11_KI270721v1_random:1493-1515 GGCAGGGGGCCCAGGCCTGCAGG - Intergenic
1092147405 12:6224095-6224117 GGCTGGGAGTGCAGGGCTGGTGG + Intronic
1092147823 12:6226938-6226960 TGCTGGGGGAGCAGGTCTGCCGG + Intronic
1096240320 12:49956306-49956328 GCCTTGGGGCCCAGCGCTGCAGG - Exonic
1096503515 12:52079651-52079673 GGGTAGGGGCGTAGGGCGCCTGG + Intergenic
1096675150 12:53222013-53222035 GGGGAGGGGCGGGGGGCTGCCGG + Intronic
1096839261 12:54370628-54370650 GTCTAGGGGCGCCGGGGAGCTGG - Exonic
1096878406 12:54648053-54648075 GGCTGGGGCCACAGGGCTCCTGG + Intronic
1097190429 12:57216891-57216913 GCCTAGGGACGCGGGGCTCCGGG - Exonic
1099955736 12:89351584-89351606 GGCTAGGGGCGCAGGGCTGCGGG - Intronic
1101340001 12:103835005-103835027 GCCCAGGGGCTCAGGGATGCGGG - Intronic
1103358951 12:120342487-120342509 GGAGAGGAGGGCAGGGCTGCGGG - Exonic
1103360926 12:120353203-120353225 GTCTAGGGGTGCATGGCTGGGGG - Intronic
1103563444 12:121804197-121804219 GGCTGGCGGCGCAGGGAGGCCGG + Exonic
1103563465 12:121804266-121804288 GGCTTGGGCCGCCCGGCTGCCGG - Intronic
1104953730 12:132453890-132453912 GGCTGGGGCTGGAGGGCTGCTGG + Intergenic
1104970291 12:132527855-132527877 GGCTAAGGGCTGAGGGCTGCAGG + Intronic
1105000750 12:132688137-132688159 GGCGAGGGGAGCGGGTCTGCGGG + Intronic
1105000762 12:132688176-132688198 GGCGAGGGGAGCGGGTCTGCGGG + Intronic
1105000787 12:132688254-132688276 GGCGAGGGGAGCGGGTCTGCGGG + Intronic
1105000799 12:132688293-132688315 GGCCAGGGGAGCGGGTCTGCGGG + Intronic
1105000882 12:132688566-132688588 GGCGAGGGGAGCGGGTCTGCGGG + Intronic
1105000904 12:132688644-132688666 GGCCAGGGGAGCGGGTCTGCGGG + Intronic
1105000930 12:132688722-132688744 GGCCAGGGGAGCGGGTCTGCGGG + Intronic
1105000956 12:132688800-132688822 GGCCAGGGGAGCGGGTCTGCGGG + Intronic
1105000982 12:132688878-132688900 GGCCAGGGGAGCGGGTCTGCGGG + Intronic
1105001065 12:132689151-132689173 GGCGAGGGGAGCGGGTCTGCGGG + Intronic
1105851510 13:24340148-24340170 GGCAAGCGGCTCAGAGCTGCGGG + Intergenic
1106246356 13:27953816-27953838 GGCCAAGGGCGCTGGGCTGCGGG - Intergenic
1106582635 13:31031343-31031365 GGCTAGAGGTGCAGGGCTGAGGG + Intergenic
1108676023 13:52738934-52738956 GGCGAGGGGCGCGCGGCTGCCGG - Intronic
1110190811 13:72727366-72727388 TGCCAGGGCCGCAGGGCTGATGG - Intronic
1110932868 13:81244936-81244958 GGAAAGGGGCGCAGGGCAGGTGG - Intergenic
1112216357 13:97434398-97434420 GGCTGGGGGCGCAGCGCGGCCGG + Exonic
1113041390 13:106107118-106107140 GCCTTGGGGAGCTGGGCTGCTGG - Intergenic
1113461292 13:110484399-110484421 GGGGAGGGGCCCAGAGCTGCGGG - Intronic
1113461437 13:110485041-110485063 GACTAGGGGCCCCTGGCTGCAGG - Intronic
1113914806 13:113863874-113863896 GGCGCGCGGCGCAGGGCGGCGGG + Exonic
1114736790 14:25050247-25050269 GGCTAGGGGCTGGGGGCTGGGGG + Exonic
1115421284 14:33198715-33198737 GGCGAATGGCGCAGGGCTGGCGG - Intronic
1116958124 14:50944453-50944475 GGCCGGAGGCGCTGGGCTGCCGG + Exonic
1119195800 14:72715869-72715891 GGCGAGGGGAGGAGGGCTGCTGG - Intronic
1121734179 14:96206319-96206341 GGCTTGGAGTGCAGGGTTGCAGG - Intronic
1122418217 14:101560500-101560522 GGCGTGGGGCGCGGGGCAGCGGG - Intergenic
1122745336 14:103894323-103894345 GGGTAGGTGTGCAGGGCTGGAGG + Intergenic
1122772516 14:104103702-104103724 GGGCTGGGGCTCAGGGCTGCAGG - Intronic
1122812704 14:104296926-104296948 GGCTTGGCGGGCAGGGCTCCTGG + Intergenic
1122910713 14:104826559-104826581 GGAGCGGGGCGCAGGGCTGGCGG - Intergenic
1122940295 14:104978169-104978191 GGGGAGGGGCGCACCGCTGCCGG + Exonic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1124066936 15:26353542-26353564 GGCTAGGACCGCAGGGGTGGGGG + Intergenic
1124494915 15:30180473-30180495 AGCTTGGCGCACAGGGCTGCTGG + Intergenic
1124748652 15:32358172-32358194 AGCTTGGCGCACAGGGCTGCTGG - Intergenic
1125722652 15:41852597-41852619 GGCTAGGGGCTGAGGGCTGGTGG - Intronic
1127393304 15:58523780-58523802 AGCTAGTGGAGCAGGGCTGGTGG + Intronic
1129172638 15:73817478-73817500 GGCCAGGGGAGCAGGGGTGCTGG - Intergenic
1129710729 15:77819216-77819238 GGCCAGGGCCGCAGGGGCGCAGG - Intronic
1129738565 15:77978896-77978918 GGCCAGCGGAGCAGGCCTGCAGG - Intergenic
1129844876 15:78763682-78763704 GGCCAGGTGAGCCGGGCTGCGGG - Exonic
1129849976 15:78788202-78788224 GTATAGGGGCCCAGGGCTGGGGG + Intronic
1130252275 15:82307375-82307397 GCGTAGGGGCTCAGGGCTGGGGG - Intergenic
1130254397 15:82319195-82319217 GGCCAGCGGGGCAGGCCTGCAGG - Intergenic
1130600568 15:85270775-85270797 GGCCAGCGGGGCAGGCCTGCAGG + Intergenic
1131510165 15:93045298-93045320 GGCTGTGGGTGCAGGGCTGGCGG + Exonic
1132195157 15:99909312-99909334 GGCTTGGGTTGCAGGGCTGCAGG + Intergenic
1132464789 16:72478-72500 GGCCGGGAGCGCAGGGCTCCGGG - Intronic
1132464989 16:73288-73310 GGGTAGGGGCACAGGGCAGGGGG - Intronic
1132585773 16:705300-705322 GGGCCGGGGCGCGGGGCTGCGGG + Intronic
1132730421 16:1358277-1358299 GGCTGGGGGAGCGGGGCAGCTGG - Intronic
1133228507 16:4354903-4354925 GGCCAGGGGTGCAGGGTGGCGGG - Exonic
1133784453 16:8963640-8963662 GGCCGGGGGCGGAGGGCGGCCGG + Intronic
1134190844 16:12120040-12120062 GGCTAGGGGAGGAGGGTGGCAGG + Intronic
1135382681 16:22007968-22007990 GGGGAGGGGCCCAGGGCGGCCGG + Intronic
1135745762 16:25015152-25015174 GGCTGGGGGCGGAGGGCGGAGGG - Intronic
1136170484 16:28486441-28486463 GACTGGGGGAGCTGGGCTGCTGG - Exonic
1136173394 16:28502051-28502073 GGCTGGGGACCCAGGGCCGCTGG - Exonic
1136402356 16:30025530-30025552 TGCTAGGGTCGCAGGGAGGCAGG - Intronic
1136447759 16:30334808-30334830 GGCTAGGGGAGGAAGGCCGCGGG - Intergenic
1136932923 16:34435329-34435351 GCTGAGGGGCCCAGGGCTGCTGG - Intergenic
1136971649 16:34976485-34976507 GCTGAGGGGCCCAGGGCTGCTGG + Intergenic
1137547538 16:49414847-49414869 GGCCAGGGGAGGAGGGCTGCCGG + Intergenic
1137619739 16:49868403-49868425 AGCTAGGGGTGCGGGGCCGCCGG + Intergenic
1138595759 16:58028114-58028136 GGCCAGGAGCTCAGGGGTGCAGG + Intronic
1139215338 16:65121451-65121473 GGGAAGCGGCGCAGGGCTGGCGG + Intronic
1141692616 16:85605176-85605198 GGCAAGGGGAGCAGGACAGCGGG - Intergenic
1141987105 16:87587254-87587276 GGGAAGGGGCGCAGGGCGGGTGG + Intergenic
1142131591 16:88433841-88433863 GGGCAGGGGCCCAAGGCTGCAGG - Exonic
1142297126 16:89231653-89231675 GGCAAGGGGTGCAGGGCTGTGGG - Exonic
1142361686 16:89630594-89630616 GGCTGGGGGAGCGGGGCTGGGGG + Intronic
1142614149 17:1125236-1125258 GGCTGCGGGCGCTGAGCTGCGGG + Exonic
1142973694 17:3630393-3630415 GGGGAGGGGCGCAGGCCTCCCGG + Intronic
1143188258 17:5023564-5023586 GGCGAGGGGGGCCGGGCTGACGG - Exonic
1143487247 17:7261717-7261739 GGCTGGGGGCCCTGGGTTGCCGG - Intronic
1143517463 17:7426989-7427011 GGCCTGAGGCCCAGGGCTGCCGG + Exonic
1144476300 17:15591988-15592010 GGTTAGGGAGGCAGTGCTGCGGG - Intronic
1144753871 17:17668018-17668040 GGCTGGGGTCTCAGGGCTGCTGG - Intergenic
1144834089 17:18147961-18147983 AGCTTGGGGCTGAGGGCTGCGGG - Intronic
1145963479 17:28901182-28901204 GGCTAGGGGCACATGCCTTCAGG + Exonic
1146682527 17:34818353-34818375 GGCTAGGGGAGAAAGGATGCAGG - Intergenic
1146798790 17:35801917-35801939 GGCCAGGGGAGAAGGGCTTCAGG + Intronic
1147044518 17:37743238-37743260 GGCTGGGGCGCCAGGGCTGCCGG - Intronic
1147200594 17:38799190-38799212 GGGCAAGGGCCCAGGGCTGCAGG + Intronic
1147456017 17:40538627-40538649 GGCATGGGGCCCAAGGCTGCCGG - Intergenic
1147591907 17:41689189-41689211 GACCAGGGTCGCAGGGCAGCGGG + Intronic
1147598856 17:41733834-41733856 GGAGAGGGGCGGGGGGCTGCGGG - Intronic
1148109629 17:45137205-45137227 GGCTGGGGGCAGAGGGCTCCAGG + Intronic
1151554105 17:74837902-74837924 GGCCAGGGGCTCTGGGCTCCAGG - Exonic
1151786163 17:76276020-76276042 GGAGAGGGCCGCAGGGCTGCTGG + Intronic
1151938927 17:77281102-77281124 AGCTGGGGGTGCAGAGCTGCGGG + Intronic
1151984674 17:77534620-77534642 GGCTGGGGGTGCTGAGCTGCAGG - Intergenic
1152247700 17:79193909-79193931 GGCTAGGGGAGCAGGCCTGATGG + Intronic
1152375226 17:79915438-79915460 GGCTGGGAGAGCAGGACTGCAGG + Intergenic
1152542102 17:80981649-80981671 GAGTGGGGGCGCTGGGCTGCAGG - Intergenic
1152649171 17:81484000-81484022 AGCCAGGGGCGCAGGGCAGAGGG + Intergenic
1152718589 17:81911525-81911547 GGCTCGGGGCGGAGGGCGGGAGG - Intergenic
1152798388 17:82319960-82319982 GGGAAGGAGCTCAGGGCTGCAGG - Intergenic
1154300462 18:13186841-13186863 GGCCAAGGGCCCAGAGCTGCTGG + Intergenic
1154502301 18:15002940-15002962 GGGTGGGGGGGCAGGGCTGCAGG + Intergenic
1156495089 18:37520255-37520277 GGCCAGGGGAGCAGGGGTCCAGG + Intronic
1157578240 18:48758224-48758246 GGCCAGGGTGTCAGGGCTGCGGG - Exonic
1158602023 18:58863800-58863822 AACGAGGGGCGCAGGGCAGCCGG + Intronic
1158947301 18:62458088-62458110 GGCCAGGGTGGCAGGGCTGCAGG - Intergenic
1160004296 18:75058085-75058107 TGCTAGGGGCTCAGTTCTGCTGG - Intronic
1160516206 18:79480511-79480533 GGCGAGGGGCACAGGGCTCTGGG - Intronic
1160534182 18:79583623-79583645 GGCTCGGGGCTCAGGGGTGGCGG - Intergenic
1160752592 19:741484-741506 GGTGAGGGGAGCTGGGCTGCAGG + Intronic
1160769218 19:822616-822638 GGCTGGGGGCTGGGGGCTGCGGG + Intergenic
1160843589 19:1157075-1157097 GGCTAGGGGCTGGGGGCTGCGGG - Intronic
1161124123 19:2546416-2546438 GCCGTGGGGCCCAGGGCTGCGGG + Intronic
1161303171 19:3552914-3552936 GGAGAGGAGTGCAGGGCTGCAGG - Intronic
1161353172 19:3804738-3804760 GGCTGGGGGCGTGGGGATGCCGG + Exonic
1161450639 19:4343625-4343647 GGCGCGGGGCGCGGGGCTGCAGG + Intronic
1162374430 19:10296370-10296392 GGCGGGGGGCGCGGCGCTGCTGG + Exonic
1162923474 19:13918073-13918095 GGCCAGAGGGCCAGGGCTGCAGG - Exonic
1163243225 19:16076834-16076856 GGCTGCGGGCGCAGGGATGTGGG - Intronic
1163754642 19:19099381-19099403 GACTGGGGGTGCAAGGCTGCTGG + Intronic
1165166877 19:33863259-33863281 GGCCAGGGGGTCAGGGCTGCAGG + Intergenic
1165353940 19:35292230-35292252 GGCAAGGGGAGCAGGGCACCGGG + Intronic
1165490851 19:36121811-36121833 GCCTAGGGGCGCGGGGTTGGGGG + Intronic
1165786163 19:38463279-38463301 GGGATGGGGAGCAGGGCTGCTGG + Intronic
1166855986 19:45782826-45782848 GGCTAGGGGGTGAGGGCTGGGGG + Intronic
1167590768 19:50403150-50403172 GGATGGGGGCACAGGGCCGCAGG - Exonic
1167961003 19:53103783-53103805 GGCTCTGGGCGCTGGGCTGTGGG - Intergenic
1202711045 1_KI270714v1_random:19537-19559 TGCTAGCCGCGCTGGGCTGCCGG - Intergenic
925309964 2:2875307-2875329 GGCCAAGGTGGCAGGGCTGCTGG - Intergenic
925362436 2:3288909-3288931 GCCCAGGGGGCCAGGGCTGCTGG - Intronic
925786075 2:7432183-7432205 GGGTGGGGGCGGGGGGCTGCGGG - Intergenic
925900448 2:8505541-8505563 GACTAGGACTGCAGGGCTGCTGG - Intergenic
926054483 2:9766397-9766419 GGCCACGGGGGCAGGGCTGGTGG - Intergenic
926742750 2:16125982-16126004 GGCCAGGGGAGGAGGGCTCCAGG - Intergenic
926914344 2:17878511-17878533 GGCCCGGGGCGCCCGGCTGCGGG + Intronic
927056865 2:19373517-19373539 GGCCATGGGGGCGGGGCTGCTGG - Intergenic
927125831 2:20012149-20012171 GGCCAGGAGCACAGGGCAGCTGG - Intronic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
927783002 2:25954447-25954469 AGCCTGGGCCGCAGGGCTGCAGG + Intronic
927905193 2:26849946-26849968 GGTTAGCGGCGCGGAGCTGCCGG + Intronic
928462173 2:31485257-31485279 GGCTAGAGGCCCAGGCCTGGAGG + Intergenic
931391291 2:61846234-61846256 GGCAAGGTGCACATGGCTGCCGG + Intronic
932045447 2:68344254-68344276 GCCTAGGGGCGTAGGCATGCTGG + Intergenic
932137719 2:69245359-69245381 GGGTAGGGGCGCTGGGGGGCGGG - Exonic
932407943 2:71526385-71526407 GGCTGGAGGCGCAGGGCTGGTGG + Intronic
933728174 2:85437967-85437989 GGCTGGGGGCGGGGGGCTGGGGG + Intergenic
933893453 2:86790709-86790731 GGCGGGGGGCGCGGGACTGCGGG - Intronic
934966796 2:98730926-98730948 GGCTGGCGGCCCCGGGCTGCGGG - Intronic
935019732 2:99218157-99218179 GGCTAGAGGTGCAGGGCAGATGG + Intronic
935595132 2:104872390-104872412 GGGTATGGGGGAAGGGCTGCAGG + Intergenic
938196692 2:129334851-129334873 GGCCAGGACCGCAAGGCTGCAGG + Intergenic
938501477 2:131833112-131833134 GGTTGGGGGGGCAGGGCTGCAGG + Intergenic
939177911 2:138771588-138771610 TGCTAAGGGAGCAGGGCAGCTGG + Intronic
942043196 2:172084564-172084586 GCCTAGGGGCTCAGATCTGCTGG - Intergenic
945142627 2:206703101-206703123 GGGTAGGGGCGGAGTGCTGAGGG + Intronic
945297313 2:208183478-208183500 GGGTGGGGGAACAGGGCTGCAGG + Intronic
948319985 2:237061409-237061431 GACTAGGGGTGGTGGGCTGCTGG - Intergenic
948370647 2:237487285-237487307 GGCGCGGGGCGCAGAGCGGCTGG - Exonic
948637469 2:239348721-239348743 GGCAAGGGGCGTAAGGCTCCAGG + Intronic
948781276 2:240323273-240323295 GGCTGAGAGCGCTGGGCTGCAGG + Intergenic
948835159 2:240622844-240622866 GGCTGGGGGCGGAGGGCCCCGGG + Intronic
948862365 2:240758781-240758803 GGCTGGCGGCACTGGGCTGCTGG + Intronic
948940036 2:241190931-241190953 GGCTGGAGGCCCAGGGCTGGTGG + Intronic
1168819525 20:763668-763690 GGCCAGGTGCGCCGGGCAGCAGG + Exonic
1169332236 20:4724998-4725020 GGAGAGGGGCGCAGGACTTCGGG + Exonic
1170999301 20:21396927-21396949 GGCCAGGAGCGCGGGGCTGCGGG - Intronic
1171341454 20:24432017-24432039 GGCTAGGGGGGCAGTTCTCCTGG - Intergenic
1171387767 20:24781605-24781627 GGCTAAGAGGGCAGGGCTGGGGG + Intergenic
1172024120 20:31936391-31936413 GGCCAGGGGTTCAAGGCTGCAGG + Intronic
1175374416 20:58514682-58514704 GCGTAGGGGAGCATGGCTGCGGG + Exonic
1175936869 20:62518025-62518047 GGCTGGGGGCCCAGGGATCCTGG - Intergenic
1176026118 20:62986465-62986487 GGGTAGGGGTGCAGGTGTGCAGG + Intergenic
1176083416 20:63285141-63285163 GGCTGGGGGTGCTGGGCTGGGGG - Intronic
1176103643 20:63375787-63375809 GGGGTGGGGTGCAGGGCTGCTGG - Intronic
1176274490 20:64255964-64255986 AGCTCCGGGCGCAGGGGTGCCGG - Intronic
1176289895 21:5038197-5038219 GGATAGGGGAGCAAAGCTGCAGG - Intronic
1176315568 21:5239462-5239484 GGCCAGGGGCCAAGGGATGCAGG - Intergenic
1178561477 21:33642837-33642859 GGCGAGGGGCTAAGGGCGGCCGG - Intronic
1179722292 21:43322636-43322658 GGCCTGGGGCGCAGGGCTCCTGG + Intergenic
1179867356 21:44225442-44225464 GGATAGGGGAGCAAAGCTGCAGG + Intronic
1180180303 21:46115955-46115977 GCCCTGGGGCGCTGGGCTGCAGG - Intronic
1180180695 21:46117555-46117577 GGCTGGGGCTGCTGGGCTGCCGG - Intronic
1180220665 21:46356051-46356073 GGCACGGGGCACAGGGCTGTGGG + Intronic
1180230587 21:46424678-46424700 GGCCGGGGGAGCAGGGCGGCGGG - Intronic
1180230603 21:46424718-46424740 GGCTGGGGGAGCAGGGTTGGGGG - Intronic
1180393362 22:12305416-12305438 GGCCAGGGGCCAAGGGATGCAGG - Intergenic
1180406388 22:12559352-12559374 GGCCAGGGGCCAAGGGATGCAGG + Intergenic
1181615824 22:24053750-24053772 TGCTAGGGGCGCAGTGTGGCAGG + Intronic
1182026709 22:27124748-27124770 GGCGAGGGTGGCAGGGTTGCCGG + Intergenic
1183586562 22:38756145-38756167 GGCTGAGCGCGCAGGGCAGCGGG - Intronic
1183650756 22:39152247-39152269 GCCCAGCAGCGCAGGGCTGCCGG + Intronic
1184187809 22:42876419-42876441 GCCTTGGGGCTCAGGGCTGAGGG + Intronic
1184227037 22:43135019-43135041 GGCTAGGGCCACAGGGCTCAAGG + Intronic
1184497029 22:44848061-44848083 AGCTCGGGGCTCAGGACTGCGGG - Intronic
1184503532 22:44888049-44888071 GGCAGGTGCCGCAGGGCTGCAGG + Exonic
1184886145 22:47345431-47345453 AGCTGGGGCCGCAGGGCTTCAGG + Intergenic
1184887628 22:47356112-47356134 GGCTTGGGTCCCAGCGCTGCTGG - Intergenic
1185316070 22:50179651-50179673 GGCTGGGGGAGCTGGGCTGGGGG - Exonic
1185374191 22:50474676-50474698 GGCTGGGGGCCGAGGGCTGGGGG - Intronic
950060182 3:10064564-10064586 AGCTAAGGGTGCAGGGGTGCTGG - Intronic
950301549 3:11883787-11883809 AGCTAAGGGTGCAGGGGTGCTGG - Intergenic
950486626 3:13277865-13277887 GGCCAGGGGCGGGGGGCTGAGGG - Intergenic
952889205 3:38029692-38029714 GGGCGGGGGCGCAGGGCAGCGGG - Intronic
954131073 3:48561213-48561235 GGCTGGGGAGGCGGGGCTGCAGG - Intronic
954420197 3:50414833-50414855 GGCCGGCGGCGCAGGGCTCCGGG + Intronic
954860893 3:53689473-53689495 GGCTGGGGGCTGGGGGCTGCAGG + Intronic
955929182 3:64038600-64038622 GGCTGGGGACGCAGGTCTGCAGG - Intergenic
961391102 3:126552805-126552827 TGCCTGGGGCGCAGGGCAGCTGG - Intronic
961680833 3:128598929-128598951 GGCCTGGGGAGCAGGGCTGAGGG - Intergenic
961717013 3:128864648-128864670 GGCCCGGGGCACAGAGCTGCCGG + Intergenic
961735937 3:129002177-129002199 GGCCAGGCGCGCAGGGCGGGCGG - Exonic
961804889 3:129482306-129482328 GGCCCGGGGCACAGAGCTGCCGG - Intronic
962330218 3:134471778-134471800 GTCTAATGGCGCAGGGCTTCTGG - Intergenic
962920955 3:139950043-139950065 AGCTAGGGAGGCAGGGCAGCAGG + Intronic
966182018 3:177197028-177197050 GGCCGGGGGCGCTGGGCCGCGGG - Intronic
966911461 3:184562390-184562412 GCCTGGGGTCGCGGGGCTGCGGG + Intronic
967055414 3:185825371-185825393 GGCGAGGGGCGCAGCGGCGCGGG - Intergenic
967108446 3:186272398-186272420 GGCTAGGGTGGGAGGGCAGCTGG - Intronic
968230640 3:197003015-197003037 GGACGGGGGCGCGGGGCTGCGGG + Exonic
968434176 4:576373-576395 GGCGAGGCGCGCGGGGCCGCGGG - Intergenic
968606517 4:1538137-1538159 GGCCAGGGGCCAAGGGCTACAGG - Intergenic
968701408 4:2059709-2059731 GGCGGGGGGCGCGGGGCCGCCGG + Exonic
968741227 4:2332719-2332741 CGCTGGTGGTGCAGGGCTGCAGG + Intronic
968817595 4:2829818-2829840 GGCCAGGGGTCCAGGGCTCCGGG - Exonic
969057371 4:4410136-4410158 GGAAAGGGGAGCAGGGCTGGGGG + Intronic
969430423 4:7150686-7150708 GGCCAGGGGAGCAAGGCTGATGG - Intergenic
969460490 4:7326429-7326451 GGCTGGGGCGGCAGGGCTGTGGG - Intronic
969652962 4:8478491-8478513 GGACAGGGGCACAGTGCTGCTGG - Intronic
969700380 4:8764618-8764640 GGCTCGGGGCTGCGGGCTGCCGG + Intergenic
970636918 4:18021018-18021040 GGCTGGGGGCGAGGGGCGGCGGG - Intronic
971387888 4:26158182-26158204 GGCCAAGGTAGCAGGGCTGCTGG - Intergenic
972152163 4:36106067-36106089 GGGTAGGGAGGCAGGGCTTCTGG - Intronic
974716024 4:65669714-65669736 GGCTCGGGGCCCCGGGGTGCGGG - Exonic
975101585 4:70520234-70520256 AGCTAGTGGGGCAGGGCAGCAGG + Intronic
978154453 4:105473652-105473674 GAGCAGAGGCGCAGGGCTGCCGG - Intronic
978620455 4:110631395-110631417 GGTTAGGGGCCGAGGGCTGTGGG + Intronic
980331358 4:131415204-131415226 GGCTAGAGGCTCAGGCCTGGAGG - Intergenic
981419858 4:144537016-144537038 GGCAAGGGGCACAGGGCAGAAGG + Intergenic
981849110 4:149207247-149207269 GGGGAGGGGCTCAGGGCTGGAGG + Intergenic
983542869 4:168931395-168931417 GGGCATGGGCACAGGGCTGCTGG - Intronic
985668461 5:1193900-1193922 GGCTGAGGGAGCCGGGCTGCTGG + Intergenic
985807805 5:2059935-2059957 GGCGAGGGGCTCAGTGCAGCAGG + Intergenic
986971728 5:13344756-13344778 GGCTGGTGGCTCAGGGTTGCGGG - Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988705984 5:33726296-33726318 GGCCTGGGGCAGAGGGCTGCAGG + Intronic
992529668 5:77642150-77642172 GTCTGGGCGCGCAGGGCGGCTGG - Intergenic
992828202 5:80569917-80569939 GCCGAGGGCCGCCGGGCTGCAGG - Intronic
993901080 5:93584680-93584702 GGCGAGGGGAGCAGGGGTGTTGG + Exonic
995402424 5:111757706-111757728 GGGCCGGGGCGCAGAGCTGCGGG - Intronic
999188518 5:149730449-149730471 GGCCAGGGGTGCTGAGCTGCGGG + Intronic
999963225 5:156779539-156779561 GGCTAAGGCTGCAGGGCTGCTGG + Intergenic
1000094371 5:157958246-157958268 GCCGAGGGGCTCAAGGCTGCAGG - Intergenic
1001556498 5:172641038-172641060 GGGAAGGCGCGCAGGGCAGCTGG - Intergenic
1001576134 5:172765185-172765207 GCAGAGGGGAGCAGGGCTGCTGG + Intergenic
1001677169 5:173528413-173528435 GGCTAGGGGTGGAGACCTGCTGG - Intergenic
1001939699 5:175731764-175731786 GGCTGGGGTCAGAGGGCTGCAGG - Intergenic
1001956938 5:175854127-175854149 GGGTAGGGGCTCAGGGGTGCTGG - Intronic
1001970732 5:175953153-175953175 GGCCAGGGGCCCATGGCTGTGGG + Intronic
1002139942 5:177132596-177132618 GGCGGGGGCCGCACGGCTGCAGG + Intergenic
1002246706 5:177890612-177890634 GGCCAGGGGCCCATGGCTGTGGG - Intergenic
1002260523 5:177990905-177990927 GGGTCGGGGAGCAGGGCTGCAGG + Intergenic
1003442620 6:6158083-6158105 AGCTATGGGAGCAGGGCTGAAGG + Intronic
1003645454 6:7910351-7910373 GGCTCGGGGCTCAGGGGTGCGGG - Intronic
1004706242 6:18126376-18126398 GGCTAGGGGCGGTGGGGTGGTGG + Intergenic
1004924189 6:20402820-20402842 GGCCAGGCGCGCGGGGCGGCGGG + Intronic
1005882435 6:30071534-30071556 TGCTGGGTGCGCAGGGCTTCGGG - Exonic
1006909235 6:37553172-37553194 GGCTAAGGGCACAAGGCTGTGGG + Intergenic
1006950966 6:37820285-37820307 GGTGAGGGGGGCAGGGCGGCGGG + Intronic
1007115595 6:39341002-39341024 GGAGAGGGGAGCAGAGCTGCAGG - Intronic
1007236117 6:40392361-40392383 GGCTTGGGGCGCGGGGCGGAGGG + Exonic
1007248503 6:40479714-40479736 GGCTTGGGGCTCAGGGCCGCTGG + Intronic
1010032914 6:71288905-71288927 GGCGGCGGGCGCGGGGCTGCGGG - Exonic
1011983929 6:93419029-93419051 GGCTCCGGGCACAGGGCTGTAGG + Intronic
1016683489 6:146856425-146856447 GGCCAAGGGTGCAGGCCTGCTGG - Intergenic
1018027524 6:159817652-159817674 GCCTACGTGCCCAGGGCTGCAGG - Intronic
1018380275 6:163252537-163252559 GGCCAGAGGGGCAGTGCTGCAGG + Intronic
1018447878 6:163874762-163874784 GGAAAGGGGCACAGGGCTGCAGG - Intergenic
1018479858 6:164179429-164179451 GGCTAGGGGGTCAGGCCAGCAGG + Intergenic
1018685459 6:166300759-166300781 GGCTGGAGCCGCAGGGCTGTGGG + Intergenic
1018829022 6:167428057-167428079 GCCTCGGGCTGCAGGGCTGCAGG - Intergenic
1018972800 6:168540243-168540265 GGCGAGGGCCTGAGGGCTGCAGG + Intronic
1019135873 6:169907492-169907514 GGCCAGGGGCACAGGGCTCAGGG + Intergenic
1019289007 7:240888-240910 GGCAGCGGGCGGAGGGCTGCGGG + Intronic
1019292940 7:259091-259113 GGCTGGGGACGCAGGCTTGCAGG + Intronic
1019480554 7:1264787-1264809 GGGCAGGGGCGCAAGGCTGCAGG - Intergenic
1019548344 7:1589456-1589478 GGCTGTGGGTGCAGGGGTGCTGG - Intergenic
1019645154 7:2124981-2125003 GGCTGAGGGCACAGGGATGCAGG + Intronic
1019775401 7:2909498-2909520 GGTGAGGGGCGCAGGGGTGAGGG - Intronic
1020100986 7:5394402-5394424 GGGTCGGGGCTGAGGGCTGCTGG - Intronic
1020220504 7:6232948-6232970 GCCAAGGGGCAGAGGGCTGCAGG - Intronic
1020279444 7:6642918-6642940 GGCTGGGGGCTCAGGGCAGCTGG + Intronic
1022524242 7:31027310-31027332 GGCTGGGGGCGGGAGGCTGCAGG + Intergenic
1022742595 7:33137384-33137406 GCCCAGGAGCGCAGGGCTCCTGG + Intronic
1023003793 7:35840333-35840355 GTCCAGGGGCTCAAGGCTGCAGG - Intronic
1023865321 7:44235615-44235637 GGGCAGGGGCGCAAGACTGCGGG + Intronic
1023965480 7:44961466-44961488 GGCTGGGGGCTGAGGGCTGAGGG + Intergenic
1023991541 7:45131881-45131903 GGCTGGGGGAGCTGGGGTGCAGG - Intergenic
1024245929 7:47470700-47470722 GGCTAGGAGGCCTGGGCTGCAGG - Intronic
1026440328 7:70438394-70438416 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1027189597 7:75989114-75989136 GGCTAGGGGTGGAGGGGTGGAGG + Intronic
1028340851 7:89718555-89718577 GACGAGGGGCGCAGGGCTGTGGG - Intergenic
1029052167 7:97700556-97700578 GGCTAGAGGCCCAGGTCTGGAGG - Intergenic
1029444279 7:100604095-100604117 GACTAGGGGCGCAGGCCGGAAGG - Exonic
1029453660 7:100656282-100656304 GGTTTGGAACGCAGGGCTGCGGG + Intronic
1029570191 7:101363598-101363620 GGTTGGGGCCGCGGGGCTGCGGG + Intronic
1029743997 7:102506721-102506743 GGCCAGGGGCCCGGGCCTGCCGG - Exonic
1029761986 7:102605884-102605906 GGCCAGGGGCCCGGGCCTGCCGG - Exonic
1033253098 7:139777515-139777537 GGCTGCGGGCGCGGGGCCGCGGG + Intronic
1033253215 7:139777860-139777882 GGCTCGGGGCTCGGGGCGGCCGG + Intronic
1034414511 7:150957529-150957551 GGCCTGGGGCCCTGGGCTGCTGG - Intronic
1035689462 8:1550292-1550314 GGCTTTGTGCGCGGGGCTGCAGG + Intronic
1036184293 8:6611289-6611311 GGGTAGGGGGGCAGGCTTGCGGG - Intronic
1036259276 8:7227800-7227822 TGCCAGGGGCGCGGGGGTGCCGG - Intergenic
1036581403 8:10078976-10078998 TGCTAGGGCCGCAGGCGTGCTGG + Intronic
1036736139 8:11318291-11318313 GGCAGGGGGCACAGGGCTGGAGG + Intronic
1037529144 8:19757091-19757113 AGCTAGGCGCGCGGGGCTGTGGG + Intronic
1037865870 8:22441519-22441541 GGCTCGGGGCGGAGGGAGGCTGG + Intronic
1037902392 8:22695341-22695363 GGGGAGGGTCGCAGGGCGGCGGG + Intergenic
1038406263 8:27325204-27325226 GGGTGGGGGCGCAGGGCGGGCGG - Intronic
1038554143 8:28494612-28494634 GGCTGGGGGCTGAGGGCTGAGGG + Intronic
1041107185 8:54454753-54454775 GTCCAGGGTCGCAGGGCTCCTGG - Intergenic
1041290162 8:56301102-56301124 GCCTTGGGGAGCAGGGCTGAGGG - Intronic
1041437984 8:57863043-57863065 GGCTAGGGCAGCTGGGGTGCAGG - Intergenic
1041561798 8:59226505-59226527 GGCTGGAGGCCCAGGCCTGCAGG - Intergenic
1041639301 8:60179451-60179473 GGCTAAGAGCCCTGGGCTGCTGG - Intergenic
1042857892 8:73285875-73285897 GCCCAGCGTCGCAGGGCTGCTGG - Intergenic
1044988677 8:97776317-97776339 GGCCAGGGGCGCGGGGCGGAGGG + Intronic
1049290697 8:141800144-141800166 GGCCAGGGGAGCGGGGCTGGCGG - Intergenic
1049341330 8:142114131-142114153 GGCCGGGGGCTGAGGGCTGCAGG + Intergenic
1049416567 8:142498142-142498164 GGGTAGGGGGGCAGGGCAGTGGG - Intronic
1049531948 8:143159433-143159455 GGCTGGGGTCGCAGGGGTCCCGG + Intronic
1049564774 8:143332301-143332323 GGCTCGGTCAGCAGGGCTGCGGG + Intronic
1049584759 8:143427787-143427809 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1049645471 8:143733895-143733917 GGCGCGGGGCGCAGGAATGCGGG - Intergenic
1049692968 8:143970831-143970853 GGCTTGGGGCGCTGGGCGACTGG + Intronic
1049745283 8:144260612-144260634 GGCTAGGCAGGCAGGCCTGCAGG + Intronic
1049777698 8:144414101-144414123 GAGTAGGGGCGCTGGGCTGGGGG + Intronic
1049812753 8:144582793-144582815 GGCTGGTGGTGGAGGGCTGCAGG + Intronic
1053720722 9:40944135-40944157 GGCCAGGGGCCAAGGGATGCAGG + Intergenic
1056350152 9:85741649-85741671 GGTAAGGGGCGCAGGGATCCGGG + Intronic
1057230319 9:93317743-93317765 AGCTGGGGGCACAGGGCAGCTGG + Intronic
1057314263 9:93958688-93958710 GGCGAGGGGCTCCGGGCGGCAGG + Intergenic
1057333990 9:94141928-94141950 GGACAGGGGCGCAGGGGTGTGGG + Intergenic
1057412154 9:94826332-94826354 GGCCAGAGGGACAGGGCTGCGGG - Intronic
1058053580 9:100428578-100428600 GGCTAGGGGACAAAGGCTGCTGG + Intronic
1058869539 9:109190422-109190444 GGCAAAGGGCACAGGGCTGGTGG + Intronic
1059913917 9:119077478-119077500 GTCTCGGGGCACAGGGGTGCAGG - Intergenic
1060666693 9:125436050-125436072 GGCTGGGGATGCAGGGCTACAGG + Intergenic
1060969355 9:127729492-127729514 ACCGAGGGGCCCAGGGCTGCTGG + Intronic
1061195698 9:129106096-129106118 GGCTAGTGGCCCAGTGCTGCAGG - Intronic
1061944789 9:133902526-133902548 GGCCAGGGGTGCTGGGGTGCAGG + Intronic
1062084641 9:134642305-134642327 GCCCCGGGGCGCGGGGCTGCGGG + Intronic
1062428713 9:136517524-136517546 GGCCAGGGGCCACGGGCTGCAGG - Intronic
1062451394 9:136617193-136617215 GGCTGGGGGCACAGGCCTGAGGG + Intergenic
1062530099 9:136995938-136995960 GGGGAGGGGGGCAGAGCTGCTGG + Intronic
1062609773 9:137368734-137368756 GGGTGGGGGCGCAGGGCCGGGGG + Intronic
1062624387 9:137436314-137436336 GGGGAGGGGCACAGGGCCGCAGG - Intronic
1062637109 9:137497330-137497352 GGCTGGGGGCCCAGGGCTGCAGG - Intronic
1203792192 EBV:157623-157645 GGCTGGGGGCGATGGACTGCTGG + Intergenic
1185462357 X:339270-339292 GCCGGGGGGGGCAGGGCTGCAGG + Intronic
1189834509 X:45006150-45006172 GGGGGGGGGCGCAGGGCTGGGGG - Intronic
1190160929 X:48030884-48030906 GGCCTGGGGTGCGGGGCTGCGGG - Intronic
1192442156 X:71182605-71182627 TGCTAGGGACTCAGAGCTGCGGG - Intergenic
1193141877 X:78036231-78036253 GGCAAGGGGCATAGGGGTGCTGG + Intronic
1194662092 X:96639044-96639066 GGCTAGAGCAGCAGGGATGCAGG - Intergenic
1194917508 X:99723311-99723333 GGCTAGAGGCCCAGGCCTGGAGG - Intergenic
1197695049 X:129540776-129540798 GGGTCAGGGCGCAGGGCTCCCGG - Exonic
1200003319 X:153072831-153072853 GGCCAGGGGAGGAGGGCGGCTGG + Intronic
1200004404 X:153077178-153077200 GGCCAGGGGAGGAGGGCGGCTGG - Intergenic
1200323823 X:155216814-155216836 GGCGAGGGGCGAGGGGCGGCGGG + Intronic
1200402719 X:156028979-156029001 GGCTGGGGGCGGGGGGGTGCGGG - Intergenic
1202269201 Y:23054012-23054034 GGCTAGTGGCCCAGGCCTGGAGG + Intergenic
1202422193 Y:24687752-24687774 GGCTAGTGGCCCAGGCCTGGAGG + Intergenic
1202448593 Y:24982326-24982348 GGCTAGTGGCCCAGGCCTGGAGG - Intergenic