ID: 1099955748

View in Genome Browser
Species Human (GRCh38)
Location 12:89351610-89351632
Sequence CCCCGCGCGCGGAGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099955732_1099955748 15 Left 1099955732 12:89351572-89351594 CCACGCGCCCCGCCCGCAGCCCT 0: 1
1: 2
2: 7
3: 98
4: 1332
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955735_1099955748 6 Left 1099955735 12:89351581-89351603 CCGCCCGCAGCCCTGCGCCCCTA 0: 1
1: 0
2: 1
3: 47
4: 355
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955737_1099955748 2 Left 1099955737 12:89351585-89351607 CCGCAGCCCTGCGCCCCTAGCCC 0: 1
1: 0
2: 4
3: 80
4: 782
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955733_1099955748 8 Left 1099955733 12:89351579-89351601 CCCCGCCCGCAGCCCTGCGCCCC 0: 1
1: 0
2: 15
3: 119
4: 914
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955736_1099955748 3 Left 1099955736 12:89351584-89351606 CCCGCAGCCCTGCGCCCCTAGCC 0: 1
1: 0
2: 2
3: 44
4: 435
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955738_1099955748 -4 Left 1099955738 12:89351591-89351613 CCCTGCGCCCCTAGCCCTGCCCC 0: 1
1: 1
2: 0
3: 65
4: 593
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955739_1099955748 -5 Left 1099955739 12:89351592-89351614 CCTGCGCCCCTAGCCCTGCCCCG 0: 1
1: 0
2: 7
3: 74
4: 693
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1099955734_1099955748 7 Left 1099955734 12:89351580-89351602 CCCGCCCGCAGCCCTGCGCCCCT 0: 1
1: 0
2: 11
3: 77
4: 646
Right 1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099955748 Original CRISPR CCCCGCGCGCGGAGTTCCCT GGG Intronic
902478349 1:16699607-16699629 CCCCGCAGGCGGAACTCCCTGGG - Intergenic
904045167 1:27604229-27604251 CCCCGCGCGCGGAGCGGCCGGGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
924624555 1:245688093-245688115 CCCCGCGCGGGGAGGAGCCTGGG + Exonic
1076598500 10:131641301-131641323 CCCCAGGAGGGGAGTTCCCTAGG + Intergenic
1076944733 10:133638088-133638110 CCCTGCCCGCGCTGTTCCCTGGG + Intergenic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1078429767 11:11280134-11280156 CCCCGGGCGGGGGGTGCCCTGGG - Intronic
1078594541 11:12674830-12674852 CCCCGCGCGCCAACTTACCTCGG - Exonic
1079714623 11:23730490-23730512 CCCCGCGCGCTGAGGTCACAGGG - Intergenic
1088893132 11:114059913-114059935 CCCGGCGCGCGGCGCTCGCTGGG - Intronic
1091313960 11:134597680-134597702 CCCCTCCCTGGGAGTTCCCTGGG + Intergenic
1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG + Intergenic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1106798976 13:33236367-33236389 CCAGGTGCGAGGAGTTCCCTGGG + Intronic
1111542629 13:89689047-89689069 CCCAGCACGAGGAGTTGCCTAGG - Intergenic
1113906019 13:113819573-113819595 ACCCGTGCTCGGAGCTCCCTGGG - Intergenic
1119431000 14:74567883-74567905 CCCCTGGCTCCGAGTTCCCTCGG + Intronic
1122183357 14:99971528-99971550 GCACGCGCGCGCAGTCCCCTCGG + Intronic
1122870327 14:104635420-104635442 CCCAGGGCGGGGACTTCCCTGGG - Intergenic
1137555046 16:49465130-49465152 GCCTGAGCGCGGGGTTCCCTCGG + Intergenic
1142683128 17:1562054-1562076 CCCAGCGCTCGGCGTCCCCTCGG + Intronic
1148550013 17:48544621-48544643 CCCCGGCCCCCGAGTTCCCTTGG - Exonic
1148818371 17:50346451-50346473 GCCCCCGCGCGCAGCTCCCTAGG - Intronic
1152689766 17:81712604-81712626 CCCCGGGCGCGGCGATCCCCGGG - Intronic
1153805408 18:8705678-8705700 CCCCGCGGGCGGAGGTGCCCCGG + Intronic
1155053454 18:22166762-22166784 ACCCGCGCGTGGAGCTTCCTGGG - Intergenic
1157148404 18:45189916-45189938 CCCAGCTCTCAGAGTTCCCTGGG + Intergenic
1160603936 18:80034675-80034697 CCCTGGGCGCGGTATTCCCTAGG + Intronic
1163329648 19:16628210-16628232 GCCCCCGCGCGGAGTACTCTGGG + Intronic
1167966980 19:53156027-53156049 CCCCGAGCTGGGAGTCCCCTGGG - Intronic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
1202712371 1_KI270714v1_random:25438-25460 CCCCGCAGGCGGAACTCCCTGGG - Intergenic
925132198 2:1501990-1502012 TCCCTCTCGGGGAGTTCCCTTGG - Intronic
931292052 2:60881740-60881762 CCCCGCCGGCAGAGGTCCCTCGG + Exonic
948406339 2:237722840-237722862 CTCCGTGCGCTGGGTTCCCTGGG + Intronic
948653320 2:239462453-239462475 CCCCGGTTCCGGAGTTCCCTGGG - Intergenic
1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG + Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1182490402 22:30667924-30667946 CCCCGCGCGGCGCGTTGCCTGGG - Intronic
957083419 3:75658316-75658338 CCCTGCCCGCGCTGTTCCCTGGG - Intergenic
958108450 3:89107563-89107585 CCCCGCTCGGGGACTTCCCTGGG - Exonic
962318677 3:134374139-134374161 CCCAGCGCGCTGCGCTCCCTGGG + Intronic
962738791 3:138348397-138348419 CCACCCGCGCCGAGTCCCCTGGG - Intronic
963160755 3:142149136-142149158 GCCCGCGCGCGGAGGGCCTTTGG - Intronic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
967858914 3:194137403-194137425 CCCCGCGCGCGATGTGACCTTGG - Intronic
968382275 4:107408-107430 CCCCGCACGAGGCGTTCCCAGGG + Intergenic
1011517095 6:88166445-88166467 CCCTCCCCGCGCAGTTCCCTCGG - Intergenic
1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG + Intergenic
1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG + Intronic
1034339065 7:150340827-150340849 CCCTGCCCGCGCTGTTCCCTGGG + Exonic
1034470556 7:151252165-151252187 CCCCCCGAGCGGAGTCCCCGTGG - Intronic
1035039040 7:155914187-155914209 CCCTGCACGCGAAGCTCCCTTGG - Intergenic
1190881559 X:54495692-54495714 CCCCGCGCGGGGAGTGGGCTCGG + Exonic
1198205418 X:134460442-134460464 CCCCGCCTGCGGGGTTCCCTGGG - Intronic
1199138971 X:144287707-144287729 CCCAGTGCGAGGAGTTGCCTGGG + Intergenic