ID: 1099963942

View in Genome Browser
Species Human (GRCh38)
Location 12:89424969-89424991
Sequence ACGTGTGCACACAAATGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099963942 Original CRISPR ACGTGTGCACACAAATGCAT AGG Intronic
900179995 1:1307134-1307156 ACGTGTGCACAAGTGTGCATCGG - Intronic
900580947 1:3408739-3408761 ACGTGTGCCAACACATGCACCGG - Intronic
900898115 1:5497990-5498012 ACATCTGCACACTCATGCATGGG - Intergenic
901190387 1:7406554-7406576 AGGTGTACACACACATGCACAGG + Intronic
901470748 1:9454746-9454768 ACATGTGCACACACGTTCATAGG + Intergenic
902516187 1:16990862-16990884 ATATGTGCACACACATTCATGGG - Intronic
902689828 1:18103840-18103862 ACGTGTCCACACACATATATAGG - Intergenic
903270108 1:22182898-22182920 ACATGTGCACAGACATGCACTGG - Intergenic
905989010 1:42316308-42316330 ACAGGTGCACACCACTGCATTGG + Intronic
906155852 1:43613529-43613551 ACATGTGCACATACATGCGTTGG + Intronic
908369275 1:63465204-63465226 ACATGTGCACACACATACATAGG - Intronic
908481085 1:64540161-64540183 ACGAATGCACACAAATGCTTAGG - Intronic
913247477 1:116882865-116882887 GTGTGTGCACACAAATCTATTGG + Intergenic
913688242 1:121254230-121254252 AAGTGTGCACATTAATGCATAGG + Intronic
914040096 1:144041872-144041894 AAGTGTGCACATTAATGCATAGG + Intergenic
914149361 1:145026047-145026069 AAGTGTGCACATTAATGCATAGG - Intronic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
920475562 1:206272729-206272751 AAGTGTGCACATTAATGCATAGG + Intronic
921342236 1:214145684-214145706 ACATATGCACACATATGCACAGG + Intergenic
1065834916 10:29648176-29648198 ACCTGTGCAGACAAAGGCTTTGG - Intronic
1069549996 10:69357212-69357234 ACGTGTCCACACAAAAACTTGGG + Intronic
1075503881 10:123004782-123004804 AAGTGGGCACAAAAATGCTTAGG - Intronic
1076240675 10:128903388-128903410 ACGGGTGCACCCAAAAGCAAAGG + Intergenic
1076473073 10:130733465-130733487 ATATGTACACACAAATACATGGG + Intergenic
1076788876 10:132766119-132766141 ACGTGCACACACAGATGCACAGG - Intronic
1077030595 11:464383-464405 CCGTGTGCCCACCACTGCATGGG + Intronic
1079615551 11:22488228-22488250 ACAAATGCACACAAATGAATAGG - Intergenic
1081387582 11:42490434-42490456 AGGTGTGCCCTCAAATGTATTGG + Intergenic
1083144324 11:60747527-60747549 ACGTGTGCACACTCACCCATAGG + Intergenic
1084449979 11:69230930-69230952 ACGTGTCCACAAGCATGCATGGG - Intergenic
1084890393 11:72233933-72233955 ACGTATGCACACACACTCATGGG - Intronic
1085297697 11:75440150-75440172 ACGTGTGCACACACACGCCCCGG - Intronic
1086926425 11:92645246-92645268 CCTTGTGCATACAAATGCTTTGG - Intronic
1087292664 11:96337451-96337473 AGTTGTTTACACAAATGCATGGG - Intronic
1087543651 11:99554436-99554458 TCATGTGCACACACATACATGGG - Intronic
1087803745 11:102533471-102533493 AAGAGTGAACACAAATGCAATGG + Intergenic
1097721348 12:63024925-63024947 ATGTGTGTACATACATGCATGGG + Intergenic
1097915054 12:65012488-65012510 TCATGTGCAAACACATGCATAGG + Intergenic
1099963942 12:89424969-89424991 ACGTGTGCACACAAATGCATAGG + Intronic
1104919689 12:132284184-132284206 ACGTGTGCACACACATGCGTGGG - Intronic
1106970106 13:35129330-35129352 AGGTGTGCACACAAAAGTAAGGG + Intronic
1108253726 13:48591128-48591150 AGGTGTGCACACACACTCATAGG - Intergenic
1109529222 13:63619237-63619259 ACGTGTGCACACACACACACAGG + Intergenic
1115101101 14:29700947-29700969 ACGCGTACACACAAATGCCTTGG - Intronic
1115105168 14:29751904-29751926 ATGTGTACACACAAATAAATGGG + Intronic
1117285540 14:54282800-54282822 AAGTGTGCACACACATGGCTGGG + Intergenic
1119683135 14:76607758-76607780 ACGTGTGCACACACATGTCAGGG + Intergenic
1120543882 14:85785457-85785479 ACATGTGAACACCAAGGCATGGG - Intergenic
1122595723 14:102889551-102889573 AAGTGTGCACTCAACTGCAACGG - Exonic
1123482937 15:20651805-20651827 AGGTGTGCACACAAAAGTAAAGG - Intergenic
1124901521 15:33827408-33827430 ACGTGTATCCACAGATGCATGGG + Intronic
1129026870 15:72584335-72584357 ACATGGGCACACAAAGGCTTGGG - Exonic
1129685803 15:77685483-77685505 ATGTGTGCACACAAGTTCACTGG - Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1135952301 16:26926584-26926606 ACATGTGCCCCAAAATGCATGGG + Intergenic
1137507370 16:49065779-49065801 ACATGTGCACACAACTGCCCGGG + Intergenic
1138532877 16:57644388-57644410 ACATATGCACACTAATGCATGGG + Intronic
1138532884 16:57644490-57644512 ACATATGCACACTCATGCATGGG + Intronic
1138532902 16:57644774-57644796 ACATATGCACACTCATGCATGGG + Intronic
1138771245 16:59666407-59666429 CCTTGTGCACACAACTGCGTTGG - Intergenic
1141421038 16:83915696-83915718 GCGGGTGCACACAAATGAGTGGG + Exonic
1141675442 16:85515066-85515088 ACGTGTGCACACACATCCATAGG - Intergenic
1145388782 17:22438593-22438615 AGGTGTGACCACAAATCCATGGG + Intergenic
1145701485 17:26833999-26834021 ACGAGTGGACACAAATGTAATGG + Intergenic
1145714849 17:27009815-27009837 ATGTGTGCACAGACATACATGGG - Intergenic
1147511193 17:41070140-41070162 ACTTGTGCAGACACCTGCATGGG - Intergenic
1148739070 17:49881647-49881669 ACGTGTGCACATATATGTGTGGG + Intergenic
1148834670 17:50459761-50459783 ACCTGTGCACTGAAATGGATAGG + Intronic
1149654768 17:58304499-58304521 ATGTGTGAACACAAAGGCCTTGG - Intronic
1151882087 17:76902143-76902165 ACGTGTGCCCACAACTGTACAGG - Intronic
1152139225 17:78526475-78526497 ACGTGTGCGAGCACATGCATGGG - Intronic
1153275910 18:3367643-3367665 ACCTATTCACACTAATGCATTGG + Intergenic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156589919 18:38475029-38475051 ACGTGTGCCGAGAAAGGCATTGG + Intergenic
1158197348 18:54903637-54903659 ACCTGTACACACAAACGCACAGG - Exonic
1159080023 18:63726247-63726269 TCGTGTGCACACAAATCAACTGG - Intronic
1159751836 18:72312378-72312400 AAATGTGCACACTAATGCATAGG + Intergenic
1160179195 18:76619692-76619714 ATGTGTGCACATAAATGTCTGGG + Intergenic
1162530395 19:11232693-11232715 ACTTGTGTCCACACATGCATGGG + Intronic
1163502550 19:17685741-17685763 CTGTGTGGACACAAATGCTTAGG - Intronic
1165718331 19:38061555-38061577 ACGTGTGCACACAGATGGCCAGG - Intronic
1167306240 19:48711487-48711509 ATGACTGCTCACAAATGCATGGG - Intergenic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
936018288 2:108975722-108975744 ACATGAGGACACAAATTCATTGG + Intronic
937018832 2:118632382-118632404 GCGTGTGCACACACATGGACTGG + Intergenic
937711126 2:124981302-124981324 ACGTGTGCACACACAAACATGGG - Intergenic
939637815 2:144604123-144604145 ATGTGTGCATAAACATGCATGGG - Intergenic
947840544 2:233204787-233204809 ACATGCACACACATATGCATAGG - Intronic
1169891935 20:10462888-10462910 TTATGTGCACACAAGTGCATGGG + Intronic
1170889358 20:20365385-20365407 ACCTGTGCACCCGCATGCATGGG - Intergenic
1172067114 20:32229283-32229305 GCTTATGAACACAAATGCATAGG + Intronic
1172273779 20:33668897-33668919 ACGTGTCCACACAAACGCGTGGG + Intronic
1173005422 20:39136383-39136405 ACATGTGCACATACATGCACAGG - Intergenic
1175728113 20:61333223-61333245 ACGCATGCACACATATGCACAGG + Intronic
1179266576 21:39808669-39808691 ACATATGCACACAAATACACAGG - Intergenic
1179333240 21:40426050-40426072 ACCTGTGAACACACATGGATTGG + Intronic
1180542384 22:16462117-16462139 AAGTGTGGAAACAAATCCATGGG + Intergenic
1181508382 22:23377067-23377089 ACGTGTGCCCCAAACTGCATGGG - Intergenic
1181861851 22:25825077-25825099 ACACGTGCACACATATGCACAGG + Intronic
1182051007 22:27312779-27312801 ATGTGTACACACACATGCATAGG + Intergenic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
950427755 3:12933733-12933755 AGAAGTGCACACAAATGCACAGG + Intronic
953188118 3:40657178-40657200 TCATGTGCACATACATGCATAGG - Intergenic
953822094 3:46215579-46215601 TCGTGTGCAAACAAATCCCTTGG - Intronic
956140577 3:66142664-66142686 ACCTAAGCACAAAAATGCATAGG + Intronic
956653433 3:71526652-71526674 TCTAGTTCACACAAATGCATGGG - Intronic
959213278 3:103416994-103417016 ACTTGTACACAAAATTGCATGGG + Intergenic
960696933 3:120405631-120405653 ACCTGTGCACACATCTGCAGTGG - Intronic
962442477 3:135435168-135435190 AAATGTGCACACATAGGCATAGG + Intergenic
962928338 3:140015281-140015303 ATGTTTACACACAAATGCCTAGG - Intronic
963561768 3:146875348-146875370 ACCTGTGGACAGAAATGCATAGG - Intergenic
963745591 3:149121510-149121532 ACTTGTGAACACATATTCATAGG - Intergenic
964094304 3:152913728-152913750 ACGTGTGCCCAGAAAAGCATAGG + Intergenic
966064683 3:175804941-175804963 ATGTTTGCAAACAAATACATTGG - Exonic
969184002 4:5462132-5462154 ATGGGTACACACAAATGCACTGG - Intronic
969464489 4:7347671-7347693 AAGTGTCCACACAAATCCACAGG - Intronic
971769945 4:30883073-30883095 ACATGTGCACACATGTGCACGGG + Intronic
972030229 4:34447047-34447069 ACGTCTGCTCAGAAATGGATAGG - Intergenic
973023598 4:45236368-45236390 TCATGAGCACCCAAATGCATGGG - Intergenic
974697877 4:65398255-65398277 AAGTGTGCACACATCTGCCTGGG - Intronic
978708536 4:111747844-111747866 ATGTGTGCATACACATGTATTGG + Intergenic
978944904 4:114483526-114483548 GCGTGTTCTCACAAATGAATTGG + Intergenic
980216771 4:129862082-129862104 AAATGTGCACACAAATTAATTGG + Intergenic
981282464 4:142974186-142974208 ATGTAAGCACACAATTGCATAGG + Intergenic
982074172 4:151721871-151721893 CCGTGTGCACACAAGCGCACGGG + Intronic
983095742 4:163559266-163559288 AAGTATACACACAAATGTATTGG + Intronic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
985986367 5:3520066-3520088 ACATGCACACACACATGCATGGG + Intergenic
986522560 5:8636297-8636319 ACATGTGCATACACATGCATAGG - Intergenic
986923000 5:12710568-12710590 ACATGTACACACACATGCATGGG - Intergenic
988306330 5:29498901-29498923 GCCTGTGCACACATATGCAGTGG + Intergenic
988491992 5:31712746-31712768 ACGTGTGCACAGAAAAGCGCAGG + Intronic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
992359622 5:76023810-76023832 ACATATGCCCACATATGCATGGG + Intergenic
992931854 5:81655765-81655787 ACGTGTACTCACAAATGCAGAGG + Intronic
993026654 5:82654680-82654702 ATTTGTTCACATAAATGCATGGG + Intergenic
994794291 5:104275282-104275304 ATATGTACACACAAATACATGGG - Intergenic
995403443 5:111767037-111767059 ACGTGTGCATTCAAATTCTTAGG - Intronic
996357739 5:122615443-122615465 ATGTGTGCATAGTAATGCATTGG - Intergenic
996812037 5:127526927-127526949 ACGTTTACACAGATATGCATAGG - Intronic
998267507 5:140677200-140677222 ATATGTACACACACATGCATGGG - Intronic
1000148717 5:158479048-158479070 AAGTGCTCACTCAAATGCATGGG + Intergenic
1000981944 5:167825573-167825595 GCGTGCACACACACATGCATAGG + Intronic
1001642643 5:173255831-173255853 ATGTATGCATATAAATGCATAGG - Intergenic
1002901539 6:1414144-1414166 GCTTGTGCAGACAGATGCATAGG - Intergenic
1005405593 6:25484407-25484429 ATGTGTGCACATAAAATCATGGG - Intronic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1010158958 6:72829349-72829371 AGGTGTGAACAAAAATGCCTTGG - Intronic
1011456020 6:87550071-87550093 AATTGTGCACACATATCCATAGG - Intronic
1012464475 6:99502176-99502198 ATTAGTGCACACGAATGCATGGG + Intronic
1013121804 6:107147995-107148017 AAGTGTGAAAACAAATGAATAGG + Intergenic
1014985073 6:127996341-127996363 ATGTTTGTACATAAATGCATGGG - Intronic
1015305494 6:131701914-131701936 ACGCGTGCACACGTATACATAGG + Intronic
1016050609 6:139526401-139526423 ACTTGGGACCACAAATGCATTGG + Intergenic
1019352991 7:563893-563915 ATGTGTGCACACGTGTGCATGGG + Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1019965246 7:4493506-4493528 ACGTGTGCACACAAAGAGATGGG + Intergenic
1020009669 7:4801215-4801237 ATGTGTGCTCACAGGTGCATGGG - Intronic
1024612231 7:51077129-51077151 CCGTATGCACACAACTGTATTGG + Intronic
1025870604 7:65429205-65429227 ACATGCACACACAAATTCATTGG + Intergenic
1027906503 7:84190935-84190957 ATGTGTACACATAAATGTATTGG + Intronic
1027907324 7:84201970-84201992 ATGTGAGAACACAATTGCATTGG - Intronic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035389085 7:158493419-158493441 ACGTATGCACACACGTACATGGG + Intronic
1035389093 7:158493575-158493597 ACGTATGCACACACGTACATGGG + Intronic
1035389101 7:158493731-158493753 ACGTATGCACACACGTACATGGG + Intronic
1036188550 8:6648130-6648152 ACGTGGGCACAGAAAGGCACAGG + Intergenic
1037165705 8:15825753-15825775 ACCTGGGCAAAAAAATGCATAGG - Intergenic
1039625374 8:39045297-39045319 AGGTGTACACACACATGTATAGG - Intronic
1039625375 8:39045317-39045339 AGGTGTACACACACATGTATAGG - Intronic
1040423108 8:47259451-47259473 ACGTGTTCACAAAAATTCCTAGG + Intergenic
1042491234 8:69400769-69400791 ACCTGTAGACAGAAATGCATAGG + Intergenic
1042663787 8:71184074-71184096 ACATGTGCACACACAAGCACAGG - Intergenic
1043027768 8:75092092-75092114 ATGTGGGCACATAAAAGCATGGG + Intergenic
1045132793 8:99175793-99175815 ACTTATGCACACAAATGCTTAGG + Intronic
1045648058 8:104318407-104318429 GCGTGTGCACTCAGATGCATGGG - Intergenic
1047738033 8:127783791-127783813 ACATGTGCTCACAAATGTAATGG - Intergenic
1048203210 8:132394219-132394241 AGGTGTCCACAGAAATGCAAAGG + Intronic
1048737103 8:137514110-137514132 GTGTGTGCACACAAATGAGTAGG + Intergenic
1049502309 8:142974012-142974034 AGGTGTGCACACAAAACCAGAGG - Intergenic
1050794434 9:9520484-9520506 ATGAGAACACACAAATGCATGGG - Intronic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1057131786 9:92659146-92659168 ACGTGAGCACACACACGTATGGG + Intronic
1057209230 9:93190676-93190698 GCCTGTGGACACAAATGCAGAGG - Intronic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1058957204 9:109960158-109960180 AAGTGTGCACAGAACAGCATGGG - Intronic
1062049796 9:134441388-134441410 ACGTGCTCACACAGATGCTTTGG + Intergenic
1185700973 X:2229568-2229590 GTGTGTGCACAGATATGCATAGG + Intronic
1186453034 X:9689069-9689091 ACTTGTGCACACACACGCACAGG - Intronic
1190000023 X:46677000-46677022 ATGTGAGTACACAAATGCACTGG + Intronic
1190217846 X:48492118-48492140 ACGTGAGCATACTCATGCATGGG - Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1199013144 X:142780479-142780501 ACATGTGCAAACACATGCAAGGG + Intergenic
1199386363 X:147227858-147227880 CCGTGCACACACAAATGTATGGG + Intergenic