ID: 1099973419

View in Genome Browser
Species Human (GRCh38)
Location 12:89523909-89523931
Sequence CTGGTTAGGGCCCGTCTGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099973419_1099973422 -6 Left 1099973419 12:89523909-89523931 CCAATCAGACGGGCCCTAACCAG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1099973422 12:89523926-89523948 AACCAGCCCCTCTCGCTTATTGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099973419 Original CRISPR CTGGTTAGGGCCCGTCTGAT TGG (reversed) Exonic
901748298 1:11389233-11389255 TTCCTTAGGGCCCCTCTGATGGG + Intergenic
901874203 1:12157562-12157584 CTGATTTGGGCCGATCTGATGGG - Intergenic
903480703 1:23651266-23651288 CTGGTTAGGGAGATTCTGATTGG + Intergenic
912486538 1:110033637-110033659 CAGGGTAGGGCCCCTGTGATGGG - Intronic
912689586 1:111794417-111794439 CCGGTTAGGGCCCAGCTGCTGGG + Intronic
919302708 1:195790928-195790950 CTGCTTTGGGCCCCTCTGGTTGG + Intergenic
920308192 1:205032285-205032307 CTGCTGAGGGCCCCTCTGCTTGG + Intergenic
921477987 1:215633206-215633228 GTGGTTAGAGCTTGTCTGATGGG + Intronic
921672880 1:217946012-217946034 CTGGCCAGGGACCGTCTGAATGG - Intergenic
1063021428 10:2132830-2132852 CTGGTTTTGGCCATTCTGATAGG - Intergenic
1066398684 10:35052333-35052355 CTGGTAAAGGCCCTTCTGAAAGG + Intronic
1077440852 11:2568328-2568350 CTGCTAAGGGCCAGTCTGCTGGG + Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1099973419 12:89523909-89523931 CTGGTTAGGGCCCGTCTGATTGG - Exonic
1103468095 12:121158054-121158076 CTGGTTTGGGCTGGTCTAATTGG + Intronic
1104110577 12:125700622-125700644 ATGGTTTGGGCCCTTCTGGTGGG + Intergenic
1113935942 13:113995675-113995697 CTGATGGGGGCCCGGCTGATGGG + Intronic
1134004789 16:10811103-10811125 ATGGGTAGGGACTGTCTGATGGG + Intronic
1136096784 16:27962732-27962754 GTGGGGAGGGCCAGTCTGATTGG - Intronic
1138185438 16:54973029-54973051 CTGGTGAGAGCACATCTGATTGG + Intergenic
1146811455 17:35907091-35907113 CTGGTTTGGGGCCGCCTGCTGGG + Intergenic
1166525019 19:43505103-43505125 CCGGTCAGGGCCCTTCTGAAGGG - Intergenic
925415177 2:3665144-3665166 CTGGAAAGGGCCTGTCTGCTTGG + Intronic
933647977 2:84827726-84827748 CTTTTAAGGGCCCGTGTGATTGG - Intronic
936074810 2:109394988-109395010 CCGGTGAGGGTCCTTCTGATTGG + Intronic
938833388 2:135074686-135074708 CTGGTTGGGGCCAGTGTCATGGG + Intronic
946379842 2:219339657-219339679 CAGGGTAGGGCCCGCATGATGGG + Intergenic
951729122 3:25791201-25791223 CTGGTTTGGGATCGTCTTATCGG + Exonic
963407832 3:144890331-144890353 CTGGTTTGGCCTCGTCTGTTGGG + Intergenic
967109328 3:186279730-186279752 CTGGTCATGGCACGTCTGTTGGG + Intronic
968819996 4:2843472-2843494 CGGGGCAGGGCCCGTCTGCTGGG + Intergenic
971437931 4:26647666-26647688 CTGGTTACTGTCCTTCTGATTGG + Intronic
980596839 4:134966020-134966042 GTGGTTAGGGCCGGTCTAAATGG - Intergenic
984802058 4:183724636-183724658 CTGCATAGGACCCGTCTGCTGGG - Intergenic
1013045347 6:106480229-106480251 CTGGTTAGGCACAGTATGATAGG + Intergenic
1020395106 7:7706354-7706376 CTGGTTAGAGCATGTATGATTGG + Intronic
1024253057 7:47520787-47520809 CTGGATGGGGCAAGTCTGATGGG + Intronic
1028692361 7:93667829-93667851 CTGGTGAGGGCCCCTCTCTTGGG + Intronic
1029795526 7:102890396-102890418 CTGGTTAAGCCCCCACTGATTGG + Intronic
1049463282 8:142739828-142739850 CCGGTTAGGGCCCGTCCCCTGGG - Intergenic
1050842492 9:10170286-10170308 CTGGCAAGGTCCCTTCTGATGGG + Intronic
1186442164 X:9595557-9595579 CTGGTCAGGGCCCTTCTTGTCGG + Intronic
1192202594 X:69076292-69076314 CTGGATATGGCCCAGCTGATGGG + Intergenic
1193056767 X:77160306-77160328 CTGGTTAGGGCAGGGCTGAGAGG - Intergenic
1198237605 X:134749991-134750013 CAGGTTAGGGCCCTTCTGCCTGG - Intronic