ID: 1099973734

View in Genome Browser
Species Human (GRCh38)
Location 12:89525510-89525532
Sequence TCCTCGCACCTGCCTGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099973734_1099973737 -7 Left 1099973734 12:89525510-89525532 CCCAAGGCAGGCAGGTGCGAGGA 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1099973737 12:89525526-89525548 GCGAGGATGCGCCTCGGCTTTGG 0: 1
1: 0
2: 0
3: 5
4: 38
1099973734_1099973739 22 Left 1099973734 12:89525510-89525532 CCCAAGGCAGGCAGGTGCGAGGA 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1099973739 12:89525555-89525577 TTTTTTTTTTAATACTTCCTAGG 0: 1
1: 2
2: 34
3: 334
4: 2720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099973734 Original CRISPR TCCTCGCACCTGCCTGCCTT GGG (reversed) Intronic
900100291 1:959551-959573 TCCTCGCAGGCGCGTGCCTTCGG - Intergenic
901243055 1:7705667-7705689 GCCTCGCACCTGTCTGCCCAGGG - Intronic
901741376 1:11344184-11344206 TCCCCTCACCTGCCTCCCTGAGG - Intergenic
904058309 1:27686655-27686677 TCCTCTCACCTGCCTGGCCTAGG - Intergenic
904605192 1:31694376-31694398 TCCTCTAAACTGCCTGGCTTTGG + Intronic
904923810 1:34029948-34029970 TCCTCCCACCTGCCTGGCACAGG - Intronic
905370046 1:37478047-37478069 TCCGCCCACCTGCCTCCCTCCGG - Intronic
908568037 1:65378953-65378975 TCCATGCACAAGCCTGCCTTTGG + Intronic
914376588 1:147078270-147078292 TCCTCGCTCCTGCCTGCTCCTGG + Intergenic
914865491 1:151424491-151424513 TTCTCCCTCCTGCCTGTCTTAGG + Intronic
917640398 1:176978132-176978154 TCCACCCACCTCCATGCCTTTGG - Intronic
920208930 1:204314100-204314122 TCCTCTTACCTGTCTTCCTTAGG + Intronic
920420016 1:205826785-205826807 TCCTGGCACCTGCATGACCTTGG + Intergenic
922035333 1:221842125-221842147 GCCAGGCATCTGCCTGCCTTAGG - Intergenic
922744369 1:228035964-228035986 TCCTCCCTCCTGCCTGCCATGGG + Intronic
922769338 1:228173642-228173664 TCCTCCCTCCTGCCCACCTTAGG + Intronic
923568412 1:235093547-235093569 TCCTCTCCCCTGCTTGCATTCGG - Intergenic
923706416 1:236348165-236348187 GCCTGGCATCTGCCTGCCCTCGG - Intergenic
1064643124 10:17434309-17434331 ACCTAGCACCTGCCTTCCTAAGG + Intronic
1066460805 10:35610650-35610672 TCCTCCTACCTGCCTGATTTCGG - Intergenic
1067059458 10:43070513-43070535 TCCTCCCTCCTGCTTGCCCTTGG - Intergenic
1069831589 10:71285284-71285306 TGCCCGCACCTGACTGCCTTGGG + Intronic
1075855159 10:125623636-125623658 GCCTCGCACCTTCCTGTCTTGGG - Intronic
1076160764 10:128242819-128242841 GCCTTGCACAGGCCTGCCTTGGG + Intergenic
1076235658 10:128862098-128862120 TCCTTGCTGCTGCCTGCCCTTGG - Intergenic
1077462335 11:2716835-2716857 TCCTGGCTCCTGCCTGCCCTCGG - Intronic
1077558197 11:3237612-3237634 GCCTCATACCTTCCTGCCTTTGG - Intergenic
1081783922 11:45733106-45733128 GCATCCCACCTGGCTGCCTTCGG - Intergenic
1082001782 11:47397150-47397172 CCCTCTCACCTGCCTGAGTTGGG + Intergenic
1083302185 11:61745103-61745125 TCCAGGCCCCTGGCTGCCTTGGG - Exonic
1083598484 11:63931800-63931822 TCCTGGCTCCTGCCCGCCCTAGG - Intergenic
1083883163 11:65558194-65558216 TCCTCGCTCCTGCCTGAGTTCGG - Exonic
1084196234 11:67524667-67524689 TCGGCCCTCCTGCCTGCCTTTGG + Intergenic
1087055459 11:93931629-93931651 TCCACGTACTTGCCTGCATTTGG - Intergenic
1087934722 11:104018964-104018986 TCCAAGCACTTCCCTGCCTTGGG + Intronic
1088769806 11:113022700-113022722 CCTACGTACCTGCCTGCCTTTGG - Intronic
1089648034 11:119892948-119892970 TCCTCGCCCCTGCCTGCACCCGG - Intergenic
1090840794 11:130486439-130486461 TCCTCCCACCTCCCCGCCTCTGG - Intergenic
1091696345 12:2630610-2630632 TCCTCCCACCGTCCTGCCTTTGG - Intronic
1093685546 12:22049676-22049698 TCCTGGCCTCCGCCTGCCTTCGG - Intronic
1095619022 12:44227054-44227076 TTCTAGGACCTGCATGCCTTTGG + Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096478806 12:51924491-51924513 TCAGGGAACCTGCCTGCCTTTGG + Intergenic
1099973734 12:89525510-89525532 TCCTCGCACCTGCCTGCCTTGGG - Intronic
1100390220 12:94141129-94141151 ACCTCCCACCTCCCTGCCCTAGG + Intergenic
1100677307 12:96881478-96881500 TCCTCACACTTGCTTGCCCTCGG + Intergenic
1100827595 12:98489534-98489556 TCCTCGCACCTCTCAGCCTCTGG + Intronic
1105304910 13:19161536-19161558 GCCTGGCACCTGCCTGCATGCGG - Intergenic
1105979218 13:25501461-25501483 GCCTCCCAGCTGCCTCCCTTAGG - Intronic
1107114090 13:36727838-36727860 GCGTGGCTCCTGCCTGCCTTAGG + Intergenic
1107362283 13:39632552-39632574 TCCTCACAGCTGCCTGCCACAGG + Intergenic
1107617985 13:42192233-42192255 TCCTAGAACATGCCTGCATTGGG - Intronic
1113562673 13:111295287-111295309 ATCTATCACCTGCCTGCCTTTGG - Intronic
1116869063 14:50054621-50054643 TACTTGCCCCTTCCTGCCTTAGG - Intergenic
1118906710 14:70028748-70028770 GCTTCCCACCTGCCTGCCTTGGG + Intronic
1119158171 14:72430648-72430670 TCCTGGCACCTGCAGGCTTTTGG + Intronic
1119596730 14:75941788-75941810 TCACCACACCTGCCTGGCTTAGG + Intronic
1119845328 14:77825282-77825304 TCCTGCCACCTCCCTACCTTTGG + Intronic
1120173935 14:81273828-81273850 TCCTCACACGTTCCTGCCTACGG - Intronic
1121691829 14:95883692-95883714 TCCTCTCACCTGGGTGCCTAGGG + Intergenic
1122231437 14:100307977-100307999 TCCGCACACCTGCCTCCCTGAGG - Intergenic
1122318352 14:100838757-100838779 CTCTCGCACCTGCCCGCCCTGGG + Intergenic
1122504992 14:102226663-102226685 CCCTTGCACCTGCCTGCTCTTGG - Intronic
1123070883 14:105642037-105642059 TCCCCACAGCTGCCTGCCCTGGG + Intergenic
1126097609 15:45100502-45100524 TCCTGGCTCCTGCCTGCTTTGGG - Intronic
1126799857 15:52288914-52288936 TCATCTCACCTGTGTGCCTTGGG - Intronic
1128229615 15:66025382-66025404 TCCTCCCTCCTCCCTGCCTCAGG - Intronic
1132404798 15:101535793-101535815 TCCTTGTCTCTGCCTGCCTTGGG - Intergenic
1133166373 16:3950367-3950389 ACCTCGCGCCTGCCTGGCATAGG - Intergenic
1133933699 16:10252305-10252327 TCCACCCACCTGCATGCCTGTGG + Intergenic
1134054024 16:11157861-11157883 TCCTAGCCCCCGCCTGCCCTCGG + Intronic
1134231773 16:12435449-12435471 GCCTCGTACCCGCCTGCCTGTGG - Intronic
1135478057 16:22795248-22795270 TCCTCTCACCAGCCTTCTTTAGG + Intergenic
1135900859 16:26458646-26458668 TCATGGCACCTGCCGTCCTTTGG + Intergenic
1137584851 16:49658289-49658311 TCTTCTCTCCTGCCTGCCTCTGG - Intronic
1138605336 16:58085006-58085028 TCCACTCCCCTCCCTGCCTTAGG + Intergenic
1139168236 16:64597032-64597054 TCCTTTCATCTGCTTGCCTTTGG - Intergenic
1139673301 16:68506299-68506321 TCTTTCCACCTGCCTGCCTTGGG - Intergenic
1140428007 16:74876894-74876916 GTCTCACACCTGGCTGCCTTTGG + Intronic
1141475095 16:84267589-84267611 CCCTCGCCCCTGACTGCCTATGG - Intergenic
1141704647 16:85658183-85658205 TCCCTGCCCCTGCCTGCCCTGGG + Intronic
1142283370 16:89160817-89160839 TCCCCGCACCAGCCCGCCCTGGG + Intergenic
1142599676 17:1047481-1047503 CCATCTCACCAGCCTGCCTTTGG - Intronic
1143112587 17:4560588-4560610 ACCTCCCACCTGCCAGGCTTGGG - Exonic
1143801879 17:9390000-9390022 TCCTTGCAGCTCCCTGCCATAGG - Intronic
1144358764 17:14470878-14470900 TCCTGGCACCTGGCAGCTTTTGG + Intergenic
1145262937 17:21365491-21365513 TCCTTGCACATGGCAGCCTTGGG - Intergenic
1147448934 17:40491811-40491833 TCCACTCACCCGCCTGCCTGGGG - Intronic
1148104817 17:45113502-45113524 TCCTAAAACCTGCCTGCCTGCGG - Exonic
1149495979 17:57117796-57117818 TCCTTGCCACTGCTTGCCTTGGG + Intronic
1149710353 17:58736165-58736187 TCCTCCCACCTTCCACCCTTAGG + Intergenic
1150133667 17:62682399-62682421 TCCTCTCCCCTGACTCCCTTGGG - Intronic
1151545214 17:74788743-74788765 TCCTCCAACCTGTCCGCCTTTGG + Intronic
1151715427 17:75828753-75828775 TCCCCGCACCACCCTGCCCTGGG + Intronic
1152544372 17:80993356-80993378 TGGCCACACCTGCCTGCCTTTGG + Intronic
1152677410 17:81648597-81648619 TCCTGGCACCTCCCTCCCCTGGG + Exonic
1155558016 18:27043212-27043234 TTCTCACTCCTGACTGCCTTTGG + Intronic
1157301321 18:46481844-46481866 ACCTGGCACCTTCCTGTCTTAGG - Intronic
1159475464 18:68915266-68915288 TCCTCACACCTGCCTCACCTTGG - Intronic
1160188255 18:76692998-76693020 GACTTGCTCCTGCCTGCCTTCGG - Intergenic
1160292351 18:77606585-77606607 CCCTCTCACCTGCCTGGATTAGG - Intergenic
1163002964 19:14380552-14380574 TCTTGGCACCTGCCTGGCATCGG + Intronic
1163063828 19:14778487-14778509 TCTTGGCACCTGCCTGGCATCGG - Exonic
1163369411 19:16893653-16893675 GCCCAGAACCTGCCTGCCTTGGG - Intronic
1164815110 19:31192903-31192925 TCCACGCATCTCCCTGGCTTTGG - Intergenic
1164871270 19:31646104-31646126 TCCTCCCACCTGCTTGCCCATGG + Intergenic
1165243527 19:34484531-34484553 TCCTGGCACCTGCCTGACACGGG - Intronic
1165942820 19:39423729-39423751 TCAGGGCTCCTGCCTGCCTTTGG + Exonic
1167357850 19:49015007-49015029 TCCTCGCACCTGCAAGCAGTGGG - Exonic
1167441911 19:49513526-49513548 GCTTCGCCCCTGCCTGCCTGGGG - Intronic
925202409 2:1979258-1979280 CCGTCTCACCTGCCTGCCTGCGG - Intronic
925336450 2:3102289-3102311 GCCTCCCACCTGCCTGTCTCAGG - Intergenic
926199007 2:10780139-10780161 TCCTGCCATCTGCCTGCCGTAGG + Intronic
929032078 2:37658585-37658607 TTCTTCCCCCTGCCTGCCTTAGG + Intronic
929604312 2:43225094-43225116 TCCGGGGACCTGCGTGCCTTTGG - Exonic
929810666 2:45186911-45186933 TCCTCCTATCTGCCTGCCTCTGG - Intergenic
930429146 2:51251619-51251641 CCCTCGCAGCTGCCTGCCTATGG + Intergenic
930857000 2:56029772-56029794 TCCTTGCACCTTACTGCCCTCGG + Intergenic
931653461 2:64489201-64489223 TCCTCAGACCTGCCTGCTCTGGG + Intergenic
932039590 2:68285146-68285168 CCCTCGCTCCTGCCTGCATCTGG - Intronic
932466309 2:71926472-71926494 TCCTCTCATCTGGGTGCCTTTGG - Intergenic
936067442 2:109343183-109343205 TAATAGCATCTGCCTGCCTTAGG + Intronic
940029673 2:149248325-149248347 TCATGGCACCTGCCTTCCTCAGG + Intergenic
940962147 2:159797939-159797961 ACCTCTCACCCGCCTGCCCTCGG - Intronic
941762926 2:169264740-169264762 TCCTCGCCCCTGCCTTTGTTAGG - Intronic
941861198 2:170282855-170282877 GCCTCAAACCTGCCTGCCTGAGG - Intronic
943204494 2:184875869-184875891 TCCTCTCACCTGGCAGCCTATGG + Intronic
943727924 2:191270938-191270960 TCCTCACAGCTGCCATCCTTTGG - Intronic
946766353 2:223044584-223044606 ACCCCGCTCCTGGCTGCCTTGGG + Intergenic
947204094 2:227644487-227644509 TCCTTGCACCACACTGCCTTTGG + Intergenic
948398903 2:237668284-237668306 TCCTAGGACATGCCAGCCTTGGG + Intronic
948919067 2:241052881-241052903 CCCTCTCACCTGCCTGCCACTGG - Intronic
949031540 2:241799551-241799573 CCCTCTCCCCTGCCTGCCTGTGG + Intronic
1170536658 20:17347292-17347314 TCCTGGCATCTGACTGCCATGGG + Intronic
1170997421 20:21376641-21376663 TCCTCCCACCTTCCGGACTTTGG - Intronic
1172172506 20:32947821-32947843 TCCTCCCACCTGCCTCCCAAAGG - Intronic
1173738284 20:45377397-45377419 CCCTCTCCCCTGCCTGCCTCTGG + Intronic
1179485301 21:41706144-41706166 TACTCCCACCTGCCTCCTTTGGG - Intergenic
1180209383 21:46285794-46285816 TCCTCCCACCTGGCTTCCCTCGG + Intronic
1181142533 22:20816972-20816994 CACTGCCACCTGCCTGCCTTTGG - Intronic
1182326773 22:29519186-29519208 TCCTGGGACCTGCCTGTCTGCGG + Intronic
1182730367 22:32485166-32485188 TACTCTCACCTGTGTGCCTTTGG + Exonic
1183831546 22:40420778-40420800 ACCTGGCACCTGCCTGGCTCAGG + Intronic
1184844608 22:47073668-47073690 TCCTCCCTGCTGCCTGCCCTGGG - Intronic
950106359 3:10391567-10391589 TCCTGCCACCTCCCTGCCTCCGG - Intronic
950535776 3:13577367-13577389 TCCAGGCACCTTCCTGCCCTGGG - Intronic
953380617 3:42469351-42469373 TCCTCCCTTCTGCCTGCTTTGGG - Intergenic
954626083 3:52022612-52022634 ACCTGGGACCTGCCTGTCTTCGG + Intergenic
956605967 3:71073356-71073378 TCCTCACCTCTTCCTGCCTTGGG + Intronic
956640609 3:71412207-71412229 TCCTGGCACCTGGGCGCCTTTGG + Intronic
960198582 3:114802522-114802544 TCCTCTCACATGCCTGAATTAGG + Intronic
960883005 3:122364964-122364986 TCCTCAGAGCTGTCTGCCTTTGG + Intronic
966998560 3:185309402-185309424 CCCTCGCACCTCCCAGCCTCTGG - Intronic
967895181 3:194389588-194389610 TCCTGGCATCGCCCTGCCTTTGG + Intergenic
969573051 4:8021427-8021449 TCCTCCCACCTGCCAGCCCCAGG + Intronic
969676109 4:8615185-8615207 ACCTCCCACCTGCCTGCTTCTGG - Intronic
977256432 4:94745876-94745898 TCCCCCCACCTGCCAGCCTTTGG - Intergenic
977597482 4:98899137-98899159 TCCTCCAACTTCCCTGCCTTGGG + Intronic
979994107 4:127410162-127410184 TCTCCACAGCTGCCTGCCTTTGG + Intergenic
980092027 4:128453179-128453201 TCCTACCACCTGCCTCCCCTGGG + Intergenic
980688940 4:136265908-136265930 TTCTCCCACCTACCTGCTTTGGG - Intergenic
981576901 4:146214908-146214930 ACCTCCCACCCTCCTGCCTTAGG - Intergenic
983045743 4:162984727-162984749 GCCTAGCTCCTGCCGGCCTTCGG + Intergenic
983330717 4:166324383-166324405 TCCTCCCTCCTCCCTACCTTTGG - Intergenic
988582789 5:32482797-32482819 TCCTCTCCCCAGCCTGCCCTTGG + Intergenic
988654843 5:33198652-33198674 TCCTCCCACCTCCCAGCCTCTGG + Intergenic
989659284 5:43781454-43781476 TCCTCCCACCTCCCACCCTTTGG + Intergenic
990890851 5:60648324-60648346 TTCCCACACCTTCCTGCCTTTGG + Intronic
997433655 5:133858474-133858496 ACCTCCCAGCCGCCTGCCTTAGG - Intergenic
998514144 5:142737479-142737501 CCCCAGCACCTTCCTGCCTTGGG - Intergenic
999310536 5:150548935-150548957 TGCTCCCACCTGCCTGCCTCAGG - Intronic
999521215 5:152352467-152352489 TCCTCTCTCCTCCTTGCCTTTGG + Intergenic
1002781914 6:373425-373447 TCCTGGCTCCTGACTGTCTTTGG - Intergenic
1002830354 6:814875-814897 CCCTCACTCCTTCCTGCCTTGGG - Intergenic
1005816272 6:29555066-29555088 CCCTCTCTCCTACCTGCCTTAGG - Intergenic
1007368579 6:41411749-41411771 CCCTCTCACCTGCCTTCCCTAGG + Intergenic
1007405040 6:41630327-41630349 TCATGGCAGCTGCATGCCTTTGG + Intergenic
1013742593 6:113305347-113305369 TTCTCCCACCTGCCTGACCTGGG - Intergenic
1016019465 6:139220473-139220495 ACCTCACTCCTGCCTCCCTTTGG - Intergenic
1017305627 6:152914997-152915019 TGAGCGCACATGCCTGCCTTTGG + Intergenic
1017929354 6:158938999-158939021 TCCTCGCATCTCCCTTCCCTGGG + Intergenic
1019709699 7:2512557-2512579 TCCTCCCTCCTCCCTTCCTTGGG - Intronic
1022958796 7:35405294-35405316 TCCTCCCATCTCCCTTCCTTTGG + Intergenic
1024232235 7:47371399-47371421 TCCTAGCAGCTGCCTGACCTTGG - Intronic
1024602355 7:50995029-50995051 TCCTAGCTCCTGCCTTCCTAGGG + Intergenic
1024720710 7:52135110-52135132 TCCTCCCACCTGGCTGCTGTGGG - Intergenic
1026260474 7:68750880-68750902 TTCTCCCACCTACCTGCCTTTGG + Intergenic
1028675362 7:93454147-93454169 CCCTTGCACCAGCCTCCCTTGGG + Intronic
1029524148 7:101085096-101085118 TGCAGGCACCTGCCTGCCTGAGG + Intergenic
1030007336 7:105132370-105132392 GGCTCCCACCTGCCCGCCTTAGG + Intronic
1030112387 7:106037964-106037986 CCCTCTCCTCTGCCTGCCTTTGG + Intergenic
1031705220 7:124972612-124972634 TCCTGGCAGCAGACTGCCTTTGG - Intergenic
1032430143 7:131854368-131854390 CCCTCCCACCTGCCTTCCTTGGG - Intergenic
1034938719 7:155216319-155216341 TCCTCCCCACTGACTGCCTTGGG - Intergenic
1037562788 8:20089528-20089550 TCCTGCCAGCTGACTGCCTTTGG - Intergenic
1038988884 8:32844332-32844354 TCCTTGCACCTGCCTTGCTGTGG + Intergenic
1040696949 8:50011376-50011398 TCATGGCACCTCCCTGCATTGGG - Intronic
1040997003 8:53412504-53412526 TCCTAGCACTTGTCTTCCTTTGG + Intergenic
1041108688 8:54466386-54466408 TCCCCGCACCCTCCTGCCCTCGG + Intergenic
1041123642 8:54612342-54612364 TCCCCACAGCTGCCTGCCATGGG + Intergenic
1042523011 8:69734194-69734216 ACCCTGCACCTGCTTGCCTTTGG + Intronic
1043562783 8:81514147-81514169 TCCTCCCAGCTTTCTGCCTTGGG - Intergenic
1047160223 8:122369825-122369847 TCCTCCCACCCTCCTGCCCTTGG - Intergenic
1048865699 8:138760187-138760209 TCCCCGCACCTGCCTGCCCAGGG + Intronic
1049548211 8:143244654-143244676 GCCTCGCCCCTGCCAGCCTTAGG - Intergenic
1049592881 8:143470513-143470535 CCCTCACACCTGCCAGCCTGTGG + Intronic
1049672607 8:143876637-143876659 TACTGGCACCTGCCTCCCCTAGG + Intronic
1054461753 9:65468839-65468861 TCCTCCCACCAGCCTCCATTGGG + Intergenic
1057169723 9:92954439-92954461 TCCAATCACCTGCCTGCTTTTGG - Intronic
1057218540 9:93243219-93243241 TCCTCCAACTTGCCTGTCTTCGG - Intronic
1059895914 9:118864954-118864976 TCCTCCTACCCTCCTGCCTTAGG + Intergenic
1059979862 9:119759728-119759750 TCATCTCACCTGTCTGCCTCAGG + Intergenic
1060043914 9:120325256-120325278 CCCTCACACCTGCCTTCCATGGG + Intergenic
1060401258 9:123350853-123350875 TCCTACCACATGCCTGCCTTAGG + Intergenic
1061077811 9:128352501-128352523 ACCTCACATCTGCCTGCCTTGGG - Intronic
1061394114 9:130333935-130333957 ACCTGTCACCTGCCTGCCTGTGG - Intronic
1061797809 9:133098488-133098510 TCCTCCCACCTGCCAGCCCAGGG - Exonic
1061914431 9:133741987-133742009 TCCTGGCACCTGCCTGGCATAGG - Intergenic
1187565624 X:20446827-20446849 TCCTCTCACTTGCCAGCCTCTGG - Intergenic
1188515385 X:30980362-30980384 CCCTCCTTCCTGCCTGCCTTGGG + Intergenic
1189280250 X:39816143-39816165 TCCTCCTACCTGCCTCCCATTGG + Intergenic
1190323680 X:49193463-49193485 TCCTCACCCCTGCCTGCCTTAGG - Exonic
1197835113 X:130686108-130686130 TCCTTACTCCTGCCTGCCTCTGG - Intronic
1197904879 X:131413984-131414006 TCCTCCCACCTGCCACCCTCAGG - Intergenic
1198265378 X:135004109-135004131 CCCTCGCCCGCGCCTGCCTTGGG + Intergenic
1199297174 X:146172458-146172480 TCCTGGCACTTGGATGCCTTAGG + Intergenic