ID: 1099973895

View in Genome Browser
Species Human (GRCh38)
Location 12:89526079-89526101
Sequence ACAGGGCTGGCGGTGTCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099973895_1099973906 4 Left 1099973895 12:89526079-89526101 CCCCGAGACACCGCCAGCCCTGT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1099973906 12:89526106-89526128 AGAGGACGGGAGGTATGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 85
1099973895_1099973902 -9 Left 1099973895 12:89526079-89526101 CCCCGAGACACCGCCAGCCCTGT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1099973902 12:89526093-89526115 CAGCCCTGTAAAGAGAGGACGGG 0: 1
1: 0
2: 1
3: 20
4: 258
1099973895_1099973907 5 Left 1099973895 12:89526079-89526101 CCCCGAGACACCGCCAGCCCTGT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1099973907 12:89526107-89526129 GAGGACGGGAGGTATGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1099973895_1099973904 -6 Left 1099973895 12:89526079-89526101 CCCCGAGACACCGCCAGCCCTGT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1099973904 12:89526096-89526118 CCCTGTAAAGAGAGGACGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 136
1099973895_1099973901 -10 Left 1099973895 12:89526079-89526101 CCCCGAGACACCGCCAGCCCTGT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1099973901 12:89526092-89526114 CCAGCCCTGTAAAGAGAGGACGG 0: 1
1: 0
2: 0
3: 21
4: 255
1099973895_1099973908 15 Left 1099973895 12:89526079-89526101 CCCCGAGACACCGCCAGCCCTGT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1099973908 12:89526117-89526139 GGTATGCGCCGGGTCAGCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099973895 Original CRISPR ACAGGGCTGGCGGTGTCTCG GGG (reversed) Exonic
904305131 1:29583967-29583989 ACAGGGCTGGACTTGTCTGGAGG + Intergenic
904397854 1:30234697-30234719 TCAGGGCTGGCAGTGACTCCAGG - Intergenic
912948595 1:114105285-114105307 ACAGGGCTGTAGGAGTCTCCAGG - Intronic
923126842 1:231040482-231040504 ACGGGGCTGGAGGTGAGTCGGGG - Intergenic
923558820 1:235022941-235022963 ACAGGGCTGTCGACGTCTAGAGG - Intergenic
924637988 1:245807017-245807039 ACAGGGCTGAAGGTGTCTTCTGG + Intronic
1064253838 10:13727471-13727493 ACAGTGATGGCGGTGGCTCCGGG + Intronic
1069624958 10:69861886-69861908 AAAGGTCTGGGGGTGTCTTGTGG + Intronic
1069748853 10:70733059-70733081 ACAGGGCTGATGGTGTCTCTTGG - Intronic
1073283384 10:102370988-102371010 ACAGGGCTGGTGCAGTCTAGCGG + Intronic
1074102975 10:110368147-110368169 ACAGGGCAGGCGCTGTCCCCTGG + Intergenic
1075683498 10:124348664-124348686 AGAGGGCTGGGGGTGTCTGGGGG - Intergenic
1076667126 10:132099761-132099783 ACAGGGCAGGCGGTGCCCAGGGG - Intergenic
1076756597 10:132575811-132575833 ACAGAGCAGGCGGTGTCACTAGG - Intronic
1076881563 10:133242020-133242042 CCTGGCCTGGTGGTGTCTCGAGG + Intergenic
1077341947 11:2030169-2030191 ACAGCGCTGGCGGTGCCCGGAGG + Intergenic
1079111393 11:17607131-17607153 TGAGGACTGGCTGTGTCTCGCGG + Intronic
1083654855 11:64224672-64224694 GCAGGGCCTGCGGTGTCTCCAGG + Exonic
1084942093 11:72618365-72618387 AGAGGGCTGGGGGTTTCTGGAGG - Intronic
1088849093 11:113690734-113690756 ACAGGGCTGGCACTGTCATGTGG + Intronic
1089214532 11:116827681-116827703 AATGGGCTGGCGGGGTCCCGTGG - Intergenic
1202824933 11_KI270721v1_random:85358-85380 ACAGCGCTGGCGGTGCCCGGAGG + Intergenic
1093876211 12:24352491-24352513 TCAGGGCTGGCGGCGGCTAGAGG + Intergenic
1096550158 12:52366943-52366965 ACAGGGCTGGAGGCTTCTCTGGG + Intronic
1099973895 12:89526079-89526101 ACAGGGCTGGCGGTGTCTCGGGG - Exonic
1110564228 13:76941691-76941713 TCAGGGCTGCTGGAGTCTCGTGG - Intergenic
1110730833 13:78877040-78877062 ACAGGCCTGCAGGTGTCTCTTGG - Intergenic
1111109231 13:83685642-83685664 GCAGGGATGGAGGTGTCTCTTGG + Intergenic
1112486713 13:99826860-99826882 ACCGAGCTGGAGTTGTCTCGGGG + Intronic
1119422686 14:74516961-74516983 CCAGGGCTGGCTGTGACTCAGGG - Intronic
1119484128 14:74977377-74977399 ACAGTCCTGGCTCTGTCTCGGGG + Intergenic
1120661269 14:87254086-87254108 GCAGGGGTGGGGGTGTCACGAGG - Intergenic
1122412375 14:101532295-101532317 TCTGGGCTGGCGGAGTCTCCGGG - Intergenic
1122460067 14:101887425-101887447 ACTGAGCTGGCGGTGGCTCCTGG - Intronic
1124216583 15:27812436-27812458 ACAGGGGTGGCAGTTTCTCCAGG + Intronic
1124404244 15:29379772-29379794 CCAGGGCTGGGGGTGGCGCGCGG + Intronic
1125731439 15:41894614-41894636 ACAGAGCTGGCCGTGGCCCGGGG + Intergenic
1126345791 15:47692693-47692715 ACATGGCTGGTGGTGTCTCCTGG + Intronic
1131617148 15:94028495-94028517 ACAGCGATGGCAGTGTCTGGAGG + Intergenic
1132500178 16:281521-281543 GCAGGCCTGGCGGTCTCTGGAGG + Intronic
1132571503 16:646403-646425 CCAGGGCTGGCAGGGTCTGGTGG - Intronic
1132622604 16:874901-874923 ACAGGGCAGAGGGTGTCTGGGGG - Intronic
1132726088 16:1338968-1338990 ACAGGGCTTGCCGTGCCTCGAGG + Exonic
1132884412 16:2176325-2176347 ACCGCGCTGGCTGTGTCCCGGGG + Exonic
1132974815 16:2705974-2705996 ACAGGGCTGGTGGGGGCTTGGGG + Intronic
1132997495 16:2830756-2830778 ACAGGGCTGCGGGTGTCTGTAGG + Exonic
1133288931 16:4705146-4705168 CCAGGGCTCGCGGTCCCTCGTGG + Exonic
1134245960 16:12540487-12540509 GCAGGGCTGGCGCCTTCTCGAGG + Intronic
1141071115 16:80955215-80955237 ACATGGCTGGGGGTGTCAAGAGG - Intergenic
1143443863 17:6996037-6996059 CCAGGGCTGCCGGCGCCTCGGGG - Intronic
1144433044 17:15212804-15212826 ACAGGGCTGGCCGCCTCTTGAGG + Intergenic
1151849374 17:76681348-76681370 CCAGGGCTGGCAGTGTGTCTTGG - Intronic
1152140292 17:78532499-78532521 CCAGGGTGGGCGGTGTCTTGGGG + Exonic
1152458117 17:80427609-80427631 GCAGGGCTGGCTCTGTCTCTCGG + Intronic
1153557760 18:6334121-6334143 ACAGGTTTGGCTGTGTCTCTTGG + Intronic
1157534214 18:48446754-48446776 ACAGGGCTGGCAGTCTCGGGCGG - Intergenic
1158682218 18:59578795-59578817 TCAGGGCTGGGGGTGGCTAGGGG + Intronic
1161089144 19:2351669-2351691 GCAGGGCTGGCTGTGGCTGGAGG - Intronic
1162935228 19:13978660-13978682 ACAGGGCTTGCGGGGCCTGGTGG + Intronic
1163296453 19:16415899-16415921 ACAAGGCTGAGGGTGTCTTGAGG - Intronic
1163758386 19:19120270-19120292 ACAGGGGTGGGAGTGTCTGGAGG - Intronic
1164527527 19:29022889-29022911 ACAGGGCTGGCAGTGGCGGGGGG - Intergenic
1165775723 19:38403334-38403356 ACAGGTATGGAGGTGTCCCGGGG + Exonic
1166232343 19:41432241-41432263 ACAGGGCTGGCTGTGTCCCGAGG + Exonic
1166888262 19:45973975-45973997 ACGGGGCTGGCGGTGGCTGCTGG + Intergenic
926841217 2:17082516-17082538 AGAGGGCTGGCAGTGTCTGATGG + Intergenic
931173342 2:59828526-59828548 CCAGGGCTGGCTGTGTTTCCTGG - Intergenic
932780655 2:74556532-74556554 ACAGGGCTGGGGGACTGTCGAGG - Exonic
935195885 2:100816030-100816052 ACAGGGCTGGAGGAGTCTGGAGG - Intergenic
935314809 2:101821594-101821616 ACAGGGCTGGAGGTTGCTCTGGG + Intronic
949035493 2:241814135-241814157 ACATGGCTGGCAGGGTCCCGGGG + Intronic
1171880106 20:30612292-30612314 TCAGGGCTGACTGTGCCTCGGGG - Intergenic
1172468159 20:35172351-35172373 ACAGGGCAGGCAGAGTCTTGGGG + Intronic
1175429231 20:58890762-58890784 ACAGCGATGGTGGTGTCTGGTGG - Intronic
1175793090 20:61754503-61754525 ACAGGGCTTGGGGTGTCCCTGGG + Intronic
1178495223 21:33080597-33080619 ACAGGGGTGGCGCTGTGTCCTGG + Intergenic
1178621983 21:34185265-34185287 TAAGGGCTGGAGCTGTCTCGGGG + Intergenic
1179954098 21:44728239-44728261 CCAGGGCTGCAGGTGTCTCCAGG - Intergenic
1180077281 21:45469158-45469180 ACAGGCCTGGGGGTGTCTCTGGG - Intronic
1183099430 22:35574862-35574884 CCAGGGCTGGGGGTGTCTACTGG - Intergenic
1184094490 22:42309271-42309293 ACAGGGCAGGCGGGGGCTCCTGG - Intronic
1184711092 22:46250005-46250027 AGAGGGCAGGCGGAGGCTCGCGG - Intronic
1185331398 22:50253556-50253578 ACACGCCTGGCGGTGCCTCGTGG + Intronic
950486737 3:13278364-13278386 GCAGGGCTCACGGTGTCACGTGG - Intergenic
961470121 3:127106202-127106224 CCAGGGCAGGCGGTGCCTCTGGG + Intergenic
963902721 3:150747493-150747515 AGAGGGCTGCCTGTGTCTCCTGG + Intronic
964840184 3:160984915-160984937 GGAGGGCTGGTGGTGTCTAGTGG + Intronic
968405850 4:338402-338424 ACAGCGCCGGCCGTGGCTCGTGG + Intronic
969559895 4:7940017-7940039 ACTGGGCTTGCGGGGTCCCGCGG + Exonic
969563223 4:7962612-7962634 TCAGGGCTGGCAGAGTCTGGTGG - Intergenic
969609280 4:8218008-8218030 ACAGGGGTGGCGGTGTTTCCAGG + Intronic
975763001 4:77636176-77636198 ACAGTGCCGGCAGTGTCTGGGGG - Intergenic
982079891 4:151778968-151778990 ACTGGGCTGGAGGTGTGTCAGGG - Intergenic
987065108 5:14281991-14282013 ACAGGGCTGGCTGTGGCTGATGG + Intronic
1000210767 5:159104565-159104587 TGAGGGCTGGCGGTGTGTCACGG - Intergenic
1006170113 6:32087598-32087620 TCAGGGCTGGCGGTGGGGCGGGG + Intronic
1013302557 6:108818170-108818192 ACATGGCTGGCGGGGACTGGAGG - Intergenic
1017040165 6:150301872-150301894 GAAGGGCTTGCGGTGTCTCAAGG - Intergenic
1020319883 7:6931859-6931881 ACAGGCCTGGCGGGGTCGGGGGG + Intergenic
1022529875 7:31060101-31060123 AGAGGGCTGGGGGTGGGTCGGGG + Intronic
1022533010 7:31078821-31078843 ACAGTGCTGTCGGTGACTTGTGG + Intronic
1023058451 7:36308155-36308177 ACGGGGCTGGCGGAAGCTCGTGG + Intergenic
1023602618 7:41894808-41894830 ACAGAGCTGACTTTGTCTCGGGG + Intergenic
1024985788 7:55192263-55192285 CCAGGGCTGTCTGTGGCTCGTGG + Intronic
1030058228 7:105601855-105601877 ACAGGGATGGCGGCGTGTCTAGG - Intergenic
1033452614 7:141475085-141475107 AAAGGGCTGGCTGTGTCCCCTGG - Exonic
1041704021 8:60826188-60826210 CCAGGACTGGTGGTGTCCCGTGG - Intronic
1046198629 8:110893459-110893481 ACAGTGCTGGCAGTGTCTGAAGG - Intergenic
1056249280 9:84731717-84731739 ACTGGGCTGCCGCTGTCTTGAGG - Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1060480820 9:124015943-124015965 AAAGGGCTGGCTGTGGCCCGGGG + Intronic
1060497745 9:124130513-124130535 ACTGGGCTGGCAGTGGCTCAGGG + Intergenic
1060523396 9:124307377-124307399 ATTGGGATGGCGGTGGCTCGGGG + Intronic
1060667134 9:125438744-125438766 ACAGGGCAGGTGGGCTCTCGGGG - Exonic
1061996867 9:134190603-134190625 ACAAAGCTGCCGGTGGCTCGTGG + Intergenic
1062086908 9:134653760-134653782 GCAGGGCTGGGGGTGTCTGCAGG + Intronic
1062327264 9:136018239-136018261 ACAGGGGTGGCTGAGCCTCGGGG + Intronic
1062555184 9:137110623-137110645 ACAGGACTGGAGGGGTCTCAAGG - Exonic
1187020957 X:15381356-15381378 ACTGGGCTGGGGGTGGCTGGAGG + Intronic
1191838299 X:65489022-65489044 ACAGAGCTGGCGGTGTGGCTTGG - Exonic
1192584262 X:72307289-72307311 ACAGGGCTGCCGGACTCGCGTGG - Intergenic
1200134545 X:153868521-153868543 ACATGGCTGGCAGTGCCTCTGGG - Intronic