ID: 1099973948

View in Genome Browser
Species Human (GRCh38)
Location 12:89526458-89526480
Sequence CAGGATATTGATATAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099973942_1099973948 29 Left 1099973942 12:89526406-89526428 CCTGAGGGCAGATTTGAATTTAT 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1099973945_1099973948 -8 Left 1099973945 12:89526443-89526465 CCACACAGTGCCCTGCAGGATAT 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1099973941_1099973948 30 Left 1099973941 12:89526405-89526427 CCCTGAGGGCAGATTTGAATTTA 0: 1
1: 0
2: 3
3: 23
4: 243
Right 1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1099973943_1099973948 2 Left 1099973943 12:89526433-89526455 CCACTGTTTTCCACACAGTGCCC 0: 1
1: 0
2: 4
3: 25
4: 298
Right 1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099973948 Original CRISPR CAGGATATTGATATAGTTGC TGG Intergenic
908793966 1:67812901-67812923 CATGACAAGGATATAGTTGCTGG + Intronic
909401973 1:75243690-75243712 CAGGAAATTAATATTGTTACTGG + Intronic
914051314 1:144135820-144135842 CATGAAATTAATAAAGTTGCAGG + Intergenic
914127867 1:144829622-144829644 CATGAAATTAATAAAGTTGCAGG - Intergenic
916810006 1:168296956-168296978 CTGGATATTGTTCTAGATGCTGG + Intronic
919470619 1:197974675-197974697 CAGGATATTCACATAATTTCAGG + Intergenic
920761250 1:208785553-208785575 AAGGATATTGAGATAGATTCTGG - Intergenic
921971702 1:221156013-221156035 CCGCATGTTGATCTAGTTGCAGG + Intergenic
922314798 1:224433884-224433906 CAGGCTGTTGCTATTGTTGCTGG + Exonic
922428569 1:225523519-225523541 CAGGCAATTCATATAGCTGCAGG + Intronic
922647907 1:227309429-227309451 CAGTATATATAAATAGTTGCTGG + Intronic
924039760 1:239972799-239972821 AAGTATGTTGATATAGATGCTGG + Intergenic
1064864321 10:19861868-19861890 CAGGATCTTGATGTAGCTGCAGG - Intronic
1065181545 10:23131192-23131214 CAGGAAATGGATACAGTTGGAGG + Intergenic
1066760618 10:38747476-38747498 CATGAAATTAATAAAGTTGCAGG - Intergenic
1068442985 10:57083777-57083799 TAGGATACTGATATAGTTGGGGG + Intergenic
1076134088 10:128032765-128032787 GAGGATTTTGAAATATTTGCAGG + Intronic
1078352034 11:10602629-10602651 CAGGATATTTATAGGGTTGCTGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1086154454 11:83650157-83650179 TAGGATATAGATATACTTGGGGG - Intronic
1086269545 11:85044943-85044965 CAGGATACTGATATAACTTCTGG + Intronic
1092340057 12:7667949-7667971 CAGGACATGGATATCGTTGATGG - Intergenic
1093762942 12:22930525-22930547 TAGGCTATTTATATATTTGCAGG - Intergenic
1094417359 12:30231530-30231552 CAGGTTAATGATATAGTCTCTGG - Intergenic
1095331683 12:40973075-40973097 CTTGATATTGATATAGTTTAAGG - Intronic
1096568782 12:52505817-52505839 CAGGATTTTGGTATATGTGCAGG + Intergenic
1097537740 12:60894717-60894739 CTGGATATGGATATGGTGGCAGG + Intergenic
1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG + Intergenic
1105001199 12:132690035-132690057 CAGGATGTTGACATAGATACTGG + Intronic
1107768063 13:43758543-43758565 CAGGATACTGACATAGATACAGG - Intronic
1108960447 13:56221401-56221423 CAGGATATTTAAATAGGTTCTGG + Intergenic
1112849417 13:103686347-103686369 CAAGATATTAATATATTTGGGGG - Intergenic
1116611439 14:47078296-47078318 CAGGATATTGATATATATGGAGG - Intronic
1119940908 14:78640216-78640238 CTAGATGTTGATATAGTTCCTGG - Intronic
1122170963 14:99875320-99875342 GAGGATAATGATATTGCTGCAGG + Intronic
1202931343 14_KI270725v1_random:37784-37806 CATGAAATTAATAAAGTTGCAGG - Intergenic
1123421087 15:20134328-20134350 CATGAAATTAATAAAGTTGCAGG + Intergenic
1123507577 15:20960149-20960171 CAGCATTTTGATATAGGTGGAGG + Intergenic
1123530312 15:21140857-21140879 CATGAAATTAATAAAGTTGCAGG + Intergenic
1123564802 15:21533892-21533914 CAGCATTTTGATATAGGTGGAGG + Intergenic
1123601058 15:21971185-21971207 CAGCATTTTGATATAGGTGGAGG + Intergenic
1125319866 15:38474611-38474633 CAGGATATAAGAATAGTTGCAGG + Intronic
1126730695 15:51679521-51679543 CCAGGTATTGAGATAGTTGCTGG - Intergenic
1202973166 15_KI270727v1_random:261004-261026 CAGCATTTTGATATAGGTGGAGG + Intergenic
1135955097 16:26949763-26949785 CAGGATATTGTTTTAGGTGCTGG - Intergenic
1136722146 16:32330552-32330574 CATGAAATTAATAAAGTTGCAGG + Intergenic
1136840470 16:33536519-33536541 CATGAAATTAATAAAGTTGCAGG + Intergenic
1141601912 16:85132023-85132045 CAGAAAATTGATATAATTGATGG + Intergenic
1203004285 16_KI270728v1_random:187222-187244 CATGAAATTAATAAAGTTGCAGG - Intergenic
1203135895 16_KI270728v1_random:1723640-1723662 CATGAAATTAATAAAGTTGCAGG - Intergenic
1203150636 16_KI270728v1_random:1836812-1836834 CATGAAATTAATAAAGTTGCAGG + Intergenic
1148496556 17:48056416-48056438 CAGGATATTGATCTGGGGGCTGG + Exonic
1149132391 17:53319141-53319163 TAAGATATTGTTTTAGTTGCTGG - Intergenic
1153555959 18:6313754-6313776 AAGGTTATTGAGATAATTGCAGG - Intronic
1155778328 18:29795983-29796005 TAGGATATGGATATATTTGGAGG + Intergenic
1156089510 18:33448983-33449005 ATGATTATTGATATAGTTGCGGG - Intergenic
1156624390 18:38890900-38890922 CATGATAATGAAAAAGTTGCCGG - Intergenic
1156935635 18:42703431-42703453 AAAGATATTCAGATAGTTGCTGG - Intergenic
1159770195 18:72539831-72539853 CAGGATTTTGATGTTGTTGTTGG - Intronic
1160808374 19:1002221-1002243 CAGGATATATATATATTGGCTGG + Intronic
1163042258 19:14611277-14611299 CAAGACATTGAGAAAGTTGCTGG - Intergenic
1202690720 1_KI270712v1_random:88456-88478 CATGAAATTAATAAAGTTGCAGG + Intergenic
926543425 2:14209061-14209083 CAGGAGAGTGATAAAGTTGCCGG - Intergenic
927627591 2:24738756-24738778 CAGGATATTAATAGATGTGCTGG - Intronic
929203345 2:39261758-39261780 CATTATATTTGTATAGTTGCTGG - Intronic
933955692 2:87367548-87367570 CATGAAATTAATAAAGTTGCAGG - Intergenic
934239844 2:90259581-90259603 CATGAAATTAATAAAGTTGCAGG - Intergenic
934273345 2:91557173-91557195 CATGAAATTAATAAAGTTGCAGG + Intergenic
934323945 2:91992278-91992300 CATGAAATTAATAAAGTTGCAGG - Intergenic
934462291 2:94222848-94222870 CATGAAATTAATAAAGTTGCAGG - Intergenic
935529026 2:104210200-104210222 CAGGATACTGTCATAGCTGCAGG - Intergenic
939445172 2:142300784-142300806 GAGGATATTTATATAATTTCAGG - Intergenic
941706474 2:168663958-168663980 CAACATTTTTATATAGTTGCTGG - Intronic
944614902 2:201450656-201450678 CAGGATATTCATCAAGTTGATGG - Intronic
1170674107 20:18463208-18463230 CAGCAAATGGATATAGTTGGAGG + Intronic
1176593372 21:8665937-8665959 CATGAAATTAATAAAGTTGCAGG - Intergenic
1177848377 21:26318218-26318240 CAGGATTTTGTTGGAGTTGCTGG - Intergenic
1179105360 21:38395718-38395740 CAGGAAATCGACACAGTTGCTGG - Intronic
1179304596 21:40142638-40142660 CAGGATATTGATATGCTTTCTGG + Exonic
1180276218 22:10643065-10643087 CATGAAATTAATAAAGTTGCAGG - Intergenic
1180550699 22:16536077-16536099 CATGAAATTAATAAAGTTGCAGG - Intergenic
1181353938 22:22283884-22283906 CATGAAATTAATAAAGTTGCAGG + Intergenic
1181561372 22:23703826-23703848 CAGGATTTTTTTATAGTTTCAGG - Intergenic
1183044254 22:35207197-35207219 CAGGATAATGGTAGAGTTTCTGG - Intergenic
950553295 3:13680550-13680572 CAGGATATTGTAACAGCTGCAGG + Intergenic
955557326 3:60151883-60151905 CAGGGAAATTATATAGTTGCAGG - Intronic
959610278 3:108286423-108286445 CAGGATGTTGATATTGATGCAGG - Intergenic
964047033 3:152340946-152340968 CAGGAAAGTGGTATAGGTGCAGG - Intronic
964048275 3:152358526-152358548 AAGGAAATAGATCTAGTTGCAGG - Intronic
964750527 3:160049992-160050014 CAGGAAATTAATACAGTTGGTGG - Intergenic
970734301 4:19148180-19148202 CAGGATATGGACATATTTGAGGG + Intergenic
971237822 4:24858799-24858821 CAGGAAATTGATAGAGCTGTCGG + Intronic
973054486 4:45638676-45638698 CAGGTTGTTGATATTGTTGGGGG - Intergenic
975944149 4:79684339-79684361 CAGTATTCTGATATAGTTCCTGG - Intergenic
977547829 4:98405789-98405811 AAGGAAAATGATATAGATGCAGG + Intronic
981578244 4:146227162-146227184 CTGGGTATTGTTATAGTTGTTGG - Intronic
983618062 4:169729690-169729712 CAGTATTTTCATAAAGTTGCTGG - Exonic
983714726 4:170766467-170766489 CAAGATATTGATATAAGTGGAGG + Intergenic
993661445 5:90641502-90641524 GAGGATATTGATATAAATGATGG + Intronic
996680484 5:126224513-126224535 CAGGACATTAAAACAGTTGCAGG + Intergenic
997390222 5:133509043-133509065 CAGGAACCTGACATAGTTGCTGG + Intronic
999792584 5:154955216-154955238 TAGGCTATTGCTATAGTTTCAGG + Intronic
1000996222 5:167961332-167961354 CAGGATATTGTCAAAGTTGATGG + Intronic
1001151035 5:169227279-169227301 CAGGATGATGATATAGTTAATGG + Intronic
1003458932 6:6311346-6311368 CAGGACATATATATAGTTGAAGG + Intronic
1003608318 6:7585562-7585584 CAGGATTTTGGCATAGCTGCTGG - Exonic
1008488869 6:52064660-52064682 CAAGATATTGTTATAGCTACTGG - Intronic
1009395140 6:63191034-63191056 CAGGATATTGGTAGAAATGCTGG - Intergenic
1013464115 6:110401805-110401827 TAGGATATTTACATAGTTTCAGG + Intronic
1017477159 6:154808683-154808705 AAGGATATGGATATAGATGAAGG + Exonic
1018873516 6:167800805-167800827 TAGGATAATGAAATATTTGCTGG - Intergenic
1022601971 7:31769513-31769535 CAGGATATGGAGAAAGTTGTGGG - Intronic
1022771003 7:33472959-33472981 CTGGGTATTGATCTAGTTCCTGG + Intronic
1033040526 7:137913588-137913610 AAGAATATTGATATAGTTTTGGG - Intronic
1036601507 8:10265084-10265106 CAGGATATTGAATCAGCTGCAGG - Intronic
1039798265 8:40933443-40933465 CAGTCTATTGATATGGGTGCCGG + Intergenic
1042404129 8:68383961-68383983 CAGGATTTTGGTATAGATGCTGG + Intronic
1044050338 8:87494410-87494432 GAGGATATTGATAAAGTGGGAGG - Intronic
1046319110 8:112547298-112547320 CATGATATTAATATATTTGGGGG + Intronic
1046725643 8:117670718-117670740 CAGAGTATTGAGATGGTTGCAGG + Intergenic
1051237721 9:15019482-15019504 CAGTATTTTCATAAAGTTGCTGG + Intergenic
1053692809 9:40603499-40603521 CATGAAATTAATAAAGTTGCAGG - Intergenic
1054272024 9:63036595-63036617 CATGAAATTAATAAAGTTGCAGG + Intergenic
1054304049 9:63402726-63402748 CATGAAATTAATAAAGTTGCAGG - Intergenic
1054402796 9:64726739-64726761 CATGAAATTAATAAAGTTGCAGG - Intergenic
1054436419 9:65212229-65212251 CATGAAATTAATAAAGTTGCAGG - Intergenic
1054493979 9:65809765-65809787 CATGAAATTAATATAGTTGCAGG + Intergenic
1054705092 9:68453834-68453856 CAGGATATTGCCTTAGATGCTGG - Intronic
1059453355 9:114384761-114384783 CAGGCTATTGATAAAGTTTTGGG + Intronic
1060361936 9:122967395-122967417 TAGGATATTTATATATTGGCAGG + Intronic
1203623410 Un_KI270749v1:145133-145155 CATGAAATTAATAAAGTTGCAGG - Intergenic
1186423471 X:9444752-9444774 CAGGAGATTGTTACAGTTACAGG + Intergenic
1189098770 X:38167585-38167607 CAAGATTTTTATATAATTGCAGG - Intronic
1192331893 X:70182367-70182389 AAGGATATTGAGATAGTTTAGGG - Intronic
1192626090 X:72730378-72730400 CATGATATTAATATAGTTTGGGG + Intergenic
1194444762 X:93974270-93974292 CAGTATGTTTTTATAGTTGCTGG + Intergenic
1194536975 X:95117793-95117815 CAGTGTATTTATGTAGTTGCTGG + Intergenic
1197890974 X:131270074-131270096 CAGAATATTGATATAATTTGAGG - Intergenic