ID: 1099977921

View in Genome Browser
Species Human (GRCh38)
Location 12:89565829-89565851
Sequence GGTGAGACTGAAGATTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099977916_1099977921 24 Left 1099977916 12:89565782-89565804 CCGGGTATTTAGTTGAGTATAGC No data
Right 1099977921 12:89565829-89565851 GGTGAGACTGAAGATTAGAGTGG No data
1099977918_1099977921 2 Left 1099977918 12:89565804-89565826 CCAAAAACATCATCAAAACTGGC No data
Right 1099977921 12:89565829-89565851 GGTGAGACTGAAGATTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099977921 Original CRISPR GGTGAGACTGAAGATTAGAG TGG Intergenic
No off target data available for this crispr