ID: 1099980695

View in Genome Browser
Species Human (GRCh38)
Location 12:89598616-89598638
Sequence GAGGAAAACACTACATGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099980692_1099980695 1 Left 1099980692 12:89598592-89598614 CCCACAGTAGTAGAAGCAGTAGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1099980695 12:89598616-89598638 GAGGAAAACACTACATGTGTAGG 0: 1
1: 0
2: 1
3: 14
4: 186
1099980691_1099980695 2 Left 1099980691 12:89598591-89598613 CCCCACAGTAGTAGAAGCAGTAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1099980695 12:89598616-89598638 GAGGAAAACACTACATGTGTAGG 0: 1
1: 0
2: 1
3: 14
4: 186
1099980693_1099980695 0 Left 1099980693 12:89598593-89598615 CCACAGTAGTAGAAGCAGTAGAA 0: 1
1: 0
2: 2
3: 26
4: 201
Right 1099980695 12:89598616-89598638 GAGGAAAACACTACATGTGTAGG 0: 1
1: 0
2: 1
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099980695 Original CRISPR GAGGAAAACACTACATGTGT AGG Intronic
900034317 1:394290-394312 GAGGAAAGCACTACATTGGGTGG + Intergenic
900055151 1:624182-624204 GAGGAAAGCACTACATTGGGTGG + Intergenic
901803362 1:11722186-11722208 GAGGCACACACAGCATGTGTGGG - Exonic
903227230 1:21900587-21900609 GAGGAGAAAACTACAGGAGTGGG + Intronic
903487686 1:23703118-23703140 TAGGAAAACACTGGATGAGTTGG + Intergenic
904445095 1:30565779-30565801 GATGAAAACATTACATTTCTAGG - Intergenic
905086046 1:35378177-35378199 GAGGAAATAACTACAAATGTGGG - Intronic
905219312 1:36433322-36433344 GAGGGAAACAGTACATGTGAGGG + Intronic
907539755 1:55203097-55203119 TAGGAAAACACAACATATATAGG + Intronic
909031875 1:70550974-70550996 GAGGGAAACATTTCAAGTGTTGG + Intergenic
909926630 1:81445257-81445279 GAAGAAGAAACTACATGTATGGG + Intronic
910411581 1:86952005-86952027 GAGGAAGTCACTACACGTGCTGG - Intronic
913407039 1:118505869-118505891 GGAGATAACACTACATGTGAAGG + Intergenic
918719409 1:187833964-187833986 GAGGAAAACAATAAGTCTGTTGG + Intergenic
918780534 1:188694207-188694229 GATGAAAACCCTACATGTCCTGG - Intergenic
918911577 1:190579122-190579144 GATAAAAACAGTAGATGTGTAGG - Intergenic
918971976 1:191431959-191431981 GAGGAAAATACTATATATGATGG - Intergenic
919543515 1:198881272-198881294 GAGGGAAAAAATAAATGTGTGGG - Intergenic
921344267 1:214166017-214166039 CAAGGAAACACTACATGTTTGGG - Intergenic
922674851 1:227543831-227543853 GTGGACACCACTGCATGTGTGGG + Intergenic
923314449 1:232766278-232766300 GAGAAAAACACTCCTTGTTTGGG + Intergenic
924337878 1:243001340-243001362 GAGGAAAGCACTACATTGGGTGG + Intergenic
1065143561 10:22743717-22743739 AAGGAAAAAACTGCATGGGTTGG - Intergenic
1065149166 10:22804330-22804352 TAGGAAAACATTACTCGTGTAGG + Intergenic
1068679708 10:59806520-59806542 GAGGAAAACAGTGCATGCGTAGG - Intronic
1070643838 10:78187739-78187761 GGGGTAAACACCATATGTGTAGG - Intergenic
1072596981 10:96882505-96882527 GAGGAGAGCTGTACATGTGTGGG - Intronic
1073917285 10:108420312-108420334 GAGAAAAACACTGCATGTCGTGG + Intergenic
1074707099 10:116143033-116143055 GATGAAAACACTCCATATTTTGG + Intronic
1079377387 11:19905817-19905839 GAGGTAAACACTACTTGTGTTGG - Intronic
1082731651 11:56805515-56805537 GAGGACAAGTCTACATTTGTAGG - Intergenic
1083004633 11:59331373-59331395 GAGGAAACAACTACATGTCATGG - Intergenic
1085553177 11:77394474-77394496 GAGGAAAAAACTGGATGTGGGGG - Intronic
1086007669 11:82058175-82058197 AAGGAAAAAAATACATGTATAGG - Intergenic
1088888641 11:114027562-114027584 GAAGAAAACACTCCAAGTGTTGG + Intergenic
1089125248 11:116172190-116172212 GATGATAAAACTACATGTTTGGG - Intergenic
1092858266 12:12695429-12695451 GAGGCAGACACTTCAGGTGTTGG + Intronic
1095743964 12:45636684-45636706 GAGGGCAACTGTACATGTGTGGG - Intergenic
1095919038 12:47510750-47510772 GAGGAAAGCAATACAAGTTTAGG - Intergenic
1096568268 12:52499271-52499293 GAGGAACACACAACATGGCTAGG + Intergenic
1097761475 12:63470434-63470456 GAGCAAAACACTACAAGCTTAGG + Intergenic
1098594245 12:72253600-72253622 GAGGGAAGCTATACATGTGTGGG - Intronic
1099280098 12:80632993-80633015 GAGGAAAACACTGCCCTTGTGGG - Intronic
1099980695 12:89598616-89598638 GAGGAAAACACTACATGTGTAGG + Intronic
1100014425 12:89991694-89991716 GAGAAAAAGACTGCCTGTGTTGG - Intergenic
1101301091 12:103483284-103483306 GGGGAACACTGTACATGTGTAGG + Intronic
1102415078 12:112754527-112754549 AAGGAAAAGACCACATGTGTAGG + Intronic
1103849279 12:123921185-123921207 GAGAAAAGAACTACATGTATTGG - Intronic
1106981432 13:35287120-35287142 GATGTAAACAATAAATGTGTGGG - Intronic
1107809813 13:44189515-44189537 GAAGGAGACACTACATGTGTGGG - Intergenic
1108018642 13:46102048-46102070 GATGAAAACAATACATCAGTAGG + Intronic
1108882368 13:55136219-55136241 GATGAAAACATAAGATGTGTTGG - Intergenic
1111552890 13:89838852-89838874 CCAGAAAAAACTACATGTGTGGG + Intergenic
1112137934 13:96603740-96603762 GATGAAAACAAGAAATGTGTTGG + Intronic
1113716752 13:112514877-112514899 GAGGAAAAAACTACATGTCCAGG + Intronic
1114805611 14:25832944-25832966 GAGCAAAACAGTTCATGAGTCGG + Intergenic
1114889088 14:26893680-26893702 GAGAAAAACACTTCAGGTGGAGG - Intergenic
1115452238 14:33561055-33561077 GAGGAAAACACTGCCTCAGTGGG + Intronic
1116316583 14:43403937-43403959 AAGGATATCACTAAATGTGTAGG - Intergenic
1118406475 14:65429008-65429030 TAGGAAAACAATACATGTATGGG + Intronic
1118456502 14:65949586-65949608 GAGGAATTCAATTCATGTGTAGG + Intergenic
1126032687 15:44515382-44515404 CAGGAAAACACTGCATCTGCTGG - Intronic
1127843064 15:62846989-62847011 GCGGAAAACCCTGCCTGTGTGGG + Intergenic
1131102630 15:89705184-89705206 GAGGAATACAATACATTTGCAGG + Intronic
1131312993 15:91307590-91307612 GACAAAAACACAACATGTGGAGG + Intergenic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1138882919 16:61037827-61037849 AATGAAAACAGTACATTTGTTGG - Intergenic
1138888490 16:61110634-61110656 GAGAAAAAGACTGCATGTATTGG - Intergenic
1141812447 16:86384568-86384590 GGGGAACTCACTACATGCGTGGG + Intergenic
1148357986 17:46988953-46988975 GAGGAAGACATAACATGTGGGGG + Intronic
1149921242 17:60661369-60661391 GAGGAAAATTTTACATGTTTGGG + Intronic
1149970353 17:61211739-61211761 AAGCATAACACTTCATGTGTGGG - Intronic
1150914742 17:69425189-69425211 GAGGAAAACACTGGAGATGTGGG - Intronic
1151778672 17:76227049-76227071 GCGGAAAAAACTACATCTGTGGG + Intronic
1160007884 18:75081612-75081634 GAGGAAGCAACTACATGTTTTGG + Intergenic
1161758190 19:6150164-6150186 TAGCAAAACACAACACGTGTTGG + Intronic
1162506491 19:11089051-11089073 AAGGAAAACACTAAAAATGTTGG - Intergenic
1164622710 19:29706737-29706759 GAGGAGAAAAATAAATGTGTGGG - Intronic
1165805334 19:38577310-38577332 TAGGAGAACACTAGATATGTTGG + Intronic
928777206 2:34780194-34780216 AATGAAAACATTACATCTGTAGG + Intergenic
929955365 2:46454156-46454178 GAGGAAAAACATACATGTTTAGG - Intronic
933493484 2:83018554-83018576 GAAGAAAACACTAAGGGTGTTGG + Intergenic
935318278 2:101859608-101859630 GAGGATAACACTAAATCTATGGG - Intronic
937787108 2:125913943-125913965 GAGGAAATAACTACATTTCTAGG - Intergenic
939347923 2:140991813-140991835 GAGAAAAACAGGACATGTTTTGG + Intronic
940975881 2:159943868-159943890 GAAGAAAACACTGCAGGTGTGGG - Intronic
941794456 2:169584469-169584491 GAGGAAAACTCTACCGGTGCAGG + Exonic
942473885 2:176294000-176294022 GATGAAAACACTGGATGTTTTGG + Intronic
942863975 2:180649926-180649948 AAGGAAATAACTGCATGTGTTGG - Intergenic
942910606 2:181238963-181238985 CAGGGAAAGACTAAATGTGTGGG + Intergenic
942942494 2:181635286-181635308 GAGGAAAAAACAATATGTCTTGG - Intronic
944218708 2:197280813-197280835 GAGAAAAAGACTAAATATGTTGG - Intronic
944992104 2:205249575-205249597 GAGGGGAACACTACATTTTTGGG - Intronic
949019227 2:241731744-241731766 GAGGAAAATACGGCATGTGCTGG - Intergenic
1171725055 20:28609424-28609446 GAGAAATAAACTAAATGTGTTGG + Intergenic
1171753013 20:29073647-29073669 GAGAAATAAACTAAATGTGTTGG - Intergenic
1171789246 20:29503914-29503936 GAGAAATAAACTAAATGTGTTGG + Intergenic
1171858283 20:30370534-30370556 GAGAAATAAACTAAATGTGTTGG - Intergenic
1173332710 20:42088343-42088365 GATGAAAACCCTGCATCTGTAGG - Intronic
1174256024 20:49255765-49255787 GAGGAACTCCCTACATGGGTTGG + Intronic
1176176453 20:63728545-63728567 GAGGAAACCACTGCAGGTGTTGG - Intronic
1177606251 21:23381312-23381334 CAGGAAAACACTCCCTGTGGAGG + Intergenic
1181376780 22:22465094-22465116 ACGGAAAACCCTACATGTGGTGG + Intergenic
949601295 3:5600799-5600821 GAGAAAAAAACTGCAGGTGTGGG + Intergenic
951604861 3:24421917-24421939 GAGCAAATCACTAAATGTCTTGG - Intronic
956256245 3:67286086-67286108 GATGTAGACATTACATGTGTAGG - Intergenic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
956445356 3:69320852-69320874 AAGGCAAAAATTACATGTGTTGG + Intronic
957139460 3:76334480-76334502 GAAGAAAACACTAAATGTTAGGG + Intronic
960640872 3:119821483-119821505 GACTCAAACACAACATGTGTTGG + Intronic
961778221 3:129305412-129305434 GAGGAAATAACTACAAGTCTTGG + Exonic
962179846 3:133194663-133194685 GTGCAAAACACAACATGGGTTGG + Intronic
964709972 3:159661597-159661619 AAGCAAAACACTACGTGTTTGGG - Intronic
965554338 3:170004175-170004197 GAGGAAATCACTTCATTTGAGGG + Intergenic
966311664 3:178601164-178601186 GAGGGAAACATTACATATGGGGG + Intronic
966705502 3:182909498-182909520 GGGGAAATCATTACATGTTTTGG - Intronic
966705505 3:182909519-182909541 GAGGAAATCATTACATTTTTGGG - Intronic
971659424 4:29392988-29393010 GAGGAAAAGAAGACATGTGTAGG + Intergenic
975025025 4:69537056-69537078 GTGGAAAATAGTAAATGTGTAGG - Intergenic
976349205 4:84041568-84041590 TAGGAGAATACTATATGTGTGGG - Intergenic
976371358 4:84292293-84292315 GTGGAAAATACTACATGCATTGG + Intergenic
976607002 4:86993342-86993364 GAGAAAAAAACTACATATATAGG - Intronic
977156237 4:93577563-93577585 GAGGAAAAGATTACATATTTTGG + Intronic
977267761 4:94876160-94876182 GAGGAACAGACTAAGTGTGTAGG - Intronic
979239259 4:118433992-118434014 GAGGAAAGCACTACATTGGGTGG - Intergenic
979730433 4:124017625-124017647 CAGGCAAATACTACATGTGTGGG + Intergenic
981614262 4:146630293-146630315 GAGGGAAACAACACATGTTTGGG + Intergenic
982717867 4:158827778-158827800 AAGGAAAACACAAAATGTGCTGG - Intronic
985025241 4:185733621-185733643 GAGGTAGACACTACATGGGAAGG + Intronic
985870911 5:2556294-2556316 GGGGAAAACAGCACATGTTTGGG + Intergenic
987319578 5:16755869-16755891 GAGGAAATCACATCATGTCTGGG - Intronic
988368202 5:30330384-30330406 GAGGAAGACAGTACATTGGTAGG - Intergenic
988918734 5:35921490-35921512 GAGGAGAACATTAAATGTGAGGG - Intronic
988995245 5:36708749-36708771 GAGAAAAACACAACATTGGTTGG + Intergenic
989484182 5:41969013-41969035 TAGAAAAACAATACATTTGTTGG - Intergenic
991436286 5:66599133-66599155 GGGGAAAAAACTACATGGTTTGG - Intronic
991997858 5:72405756-72405778 TAGGAAATTACTAAATGTGTCGG + Intergenic
993465969 5:88247862-88247884 GAACAACAAACTACATGTGTGGG + Intronic
993604655 5:89973782-89973804 GAGGAAAAAAATATATGTGGGGG + Intergenic
995404897 5:111783938-111783960 GAGGTTATCACTACTTGTGTAGG - Intronic
995757497 5:115524669-115524691 GACAAGAATACTACATGTGTAGG - Exonic
999153014 5:149439006-149439028 GAGGAAAAGACTCTTTGTGTGGG + Intergenic
1000507030 5:162133816-162133838 GAGAAAACCACTACATTTGGAGG + Intronic
1001120094 5:168972917-168972939 GAGGAAAAGAATCCATGTGGGGG - Intronic
1002739503 5:181424578-181424600 GAGGAAAGCACTACATTGGGTGG - Intergenic
1003785594 6:9482759-9482781 GGGGAAAACTATACATGTTTTGG + Intergenic
1004041596 6:11983678-11983700 GAGGCATACACTCCTTGTGTCGG + Intergenic
1006210921 6:32394016-32394038 GTGGAAAACACTGCTTGTTTGGG - Exonic
1008208574 6:48692916-48692938 GAGGAAAACAATAGATATGGGGG + Intergenic
1009459615 6:63896476-63896498 GAGGAAGGCTGTACATGTGTGGG - Intronic
1010064889 6:71670776-71670798 GAGGAAGTCACTACAGATGTGGG + Intergenic
1011059423 6:83247654-83247676 GAGGAAAGTATTACATCTGTGGG + Intronic
1012928475 6:105292041-105292063 GAGGAAGTCACTGCATATGTTGG - Intronic
1012955870 6:105569346-105569368 GAGGGATACACTACCTGTGGGGG - Intergenic
1013580588 6:111530313-111530335 GAGGAAATAAATACATGAGTGGG - Intergenic
1014131865 6:117844636-117844658 GTTGAAAACCATACATGTGTGGG - Intergenic
1015074645 6:129141084-129141106 GAGGAAATCGCTACATGTCTAGG - Intronic
1016922062 6:149305754-149305776 GAGGAAAAAATGACATGTGAAGG - Intronic
1018281507 6:162190878-162190900 GAAGTAAAAACTACATCTGTAGG - Intronic
1019244619 6:170700149-170700171 GAGGAAAGCACTACATTGGGTGG - Intergenic
1023244244 7:38183511-38183533 AAAGAAATCACTACATGAGTAGG - Intronic
1023941052 7:44768581-44768603 GAGGAAGCCACTGCATCTGTTGG + Exonic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1029101974 7:98138524-98138546 GAGTAAAACCCTACAGGTCTGGG - Intronic
1029473099 7:100766879-100766901 TAGGGAAACACCACATCTGTGGG + Intronic
1029913395 7:104179986-104180008 GAGGAAAACATTGCTTTTGTAGG - Intronic
1032695073 7:134328574-134328596 GAGGAAAACAAAATATGTCTTGG - Intergenic
1032702566 7:134395453-134395475 TAGGGAAACTGTACATGTGTTGG + Intergenic
1032792345 7:135251765-135251787 AAGCACAACACTTCATGTGTTGG - Intronic
1035503507 8:108027-108049 GAGGAAAGCACTACATTGGGTGG + Intergenic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1037201829 8:16263409-16263431 TAGAAAAACATTACATGTATTGG - Intronic
1037464257 8:19144022-19144044 GAGGAAAACACAGCATTTGCTGG - Intergenic
1038312429 8:26454928-26454950 GAGAAAATCATTACGTGTGTGGG - Intronic
1040886599 8:52270052-52270074 TAGAAAAATATTACATGTGTCGG - Intronic
1044468662 8:92539030-92539052 AAGGAAAACATTACTTGTTTGGG + Intergenic
1044653428 8:94523178-94523200 GAGGACAAGAGTACAAGTGTAGG - Intronic
1048419034 8:134258893-134258915 TAGGAAAACTCTCCAAGTGTGGG + Intergenic
1055850480 9:80622518-80622540 TAAGAAAACAATATATGTGTGGG + Intergenic
1057975904 9:99605935-99605957 GAGGGAAACGCTTCATTTGTGGG - Intergenic
1058129830 9:101238970-101238992 AAGAGAAACACTGCATGTGTAGG - Intronic
1059059181 9:111017015-111017037 GAGGAGAACTCTTCATGTGCTGG - Intronic
1203450251 Un_GL000219v1:106224-106246 GAGAAATAAACTAAATGTGTTGG + Intergenic
1203604809 Un_KI270748v1:49379-49401 GAGGAAAGCACTACATTGGGTGG - Intergenic
1185635490 X:1548928-1548950 GAAGAAAACACAGCATGGGTGGG + Intergenic
1186078954 X:5909627-5909649 AGGGAAAACAGTACGTGTGTGGG + Intronic
1186169848 X:6865083-6865105 GAGGCAAACACTACTTTAGTTGG - Intergenic
1186704356 X:12126334-12126356 GAGGAGAATACTACATTTCTTGG + Intergenic
1188679614 X:32985831-32985853 AGGTAAAACACTTCATGTGTGGG + Intronic
1188913124 X:35875222-35875244 GAGGAAAGCTGTACAAGTGTGGG + Intergenic
1189296757 X:39923906-39923928 GAGGAAAAAACATCACGTGTGGG - Intergenic
1189310801 X:40015942-40015964 CAGGAAAACACTACGTGAGGAGG - Intergenic
1189565006 X:42232519-42232541 GAGAAAAACACTACATCTGCAGG - Intergenic
1190607073 X:52154825-52154847 CAGGAAAAGACAACAAGTGTTGG + Intergenic
1191204158 X:57816710-57816732 GAGAAAAACCCCACATGTGGTGG + Intergenic
1194752839 X:97704075-97704097 AAGCAAAACTCTAAATGTGTGGG + Intergenic
1197833067 X:130665893-130665915 TTGGAAAAGGCTACATGTGTTGG + Intronic
1198803649 X:140472685-140472707 AAGGAAAACACAAAATTTGTTGG + Intergenic
1198926776 X:141805792-141805814 GAGGAAATTACTTGATGTGTGGG + Intergenic
1201566326 Y:15368699-15368721 AAGGAAAACAGCACATGTGGGGG - Intergenic
1202387000 Y:24335775-24335797 GAGGAAAGCACTACATTGGGTGG - Intergenic
1202483786 Y:25334353-25334375 GAGGAAAGCACTACATTGGGTGG + Intergenic