ID: 1099982785

View in Genome Browser
Species Human (GRCh38)
Location 12:89625823-89625845
Sequence ACTGCTCTCTAGGAGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099982785 Original CRISPR ACTGCTCTCTAGGAGTATGA TGG (reversed) Intronic
902728272 1:18351546-18351568 ACTGCTCTCTGGGGGGAGGACGG + Intronic
903267853 1:22168986-22169008 ACTACTCACTTTGAGTATGACGG - Intergenic
905111107 1:35595167-35595189 ACTTCTCTCTGAGAGTAGGAAGG - Exonic
907192679 1:52662110-52662132 ACTGTTCTCTAGGGGTTTCACGG - Intronic
910460124 1:87440035-87440057 ACTGCTCTCTAGTAGTGGGAAGG - Intergenic
914317352 1:146526301-146526323 ACTGCTCTCCAGTAGTGGGAAGG - Intergenic
914497004 1:148207059-148207081 ACTGCTCTCCAGTAGTGGGAAGG + Intergenic
924294127 1:242568323-242568345 ATTTCTCTCTTGGGGTATGATGG - Intergenic
924400781 1:243678405-243678427 ACTGATCTCTAGAAGAATGGGGG + Intronic
1065997441 10:31071953-31071975 AATGCTCTGTAAGAGTCTGATGG + Intergenic
1066779653 10:38930491-38930513 AATGATCTCTATGTGTATGAGGG - Intergenic
1067730304 10:48805728-48805750 ACTGCTCTTCAGGAGTCTGCAGG - Intronic
1068173470 10:53425701-53425723 AATGCTATCTTGGATTATGATGG - Intergenic
1068934828 10:62625351-62625373 ACTGCTCTGAGGGAGAATGAGGG + Intronic
1070398236 10:76031536-76031558 ACAGCTTTCTAGGAGTATGGAGG + Intronic
1073982219 10:109167602-109167624 GCTGCTTTCTTGAAGTATGAAGG - Intergenic
1077399743 11:2348531-2348553 ACTGCACTGTAGGAGACTGAGGG - Intergenic
1077999810 11:7484736-7484758 AATGCTCTCCAGGAGTCAGAAGG - Intergenic
1078898011 11:15615252-15615274 ACTGTCAACTAGGAGTATGAAGG - Intergenic
1080035871 11:27710313-27710335 GGTGCTCTCTAGGAGGAAGATGG + Intronic
1080689619 11:34545477-34545499 ATTGCTCTCAAAGAGTAAGAAGG + Intergenic
1082745599 11:56958180-56958202 ATTGCTCTCTAAGAGTTTTAAGG + Intergenic
1088460794 11:110080782-110080804 ACTACTCTCTGGGAATAGGATGG - Intergenic
1089681574 11:120121761-120121783 CCTGCTCTGTAGGAGACTGAGGG - Intronic
1097018008 12:56000701-56000723 ACTTCTCACTAGGATTATAAGGG + Intronic
1099982785 12:89625823-89625845 ACTGCTCTCTAGGAGTATGATGG - Intronic
1101490994 12:105209371-105209393 ACTGCTCGTTAGTAGTAAGAAGG - Intronic
1102118820 12:110424753-110424775 TCTGCTCTCTAGGACCATAATGG - Intergenic
1106470694 13:30051720-30051742 GCTGCTTTCTAGGAGGAAGAAGG + Intergenic
1106669692 13:31891305-31891327 ACTGTTCTCAAGGAATATGTAGG - Intergenic
1111383534 13:87493242-87493264 ACTGCTCTGTAGGATTTAGATGG - Intergenic
1202937607 14_KI270725v1_random:105764-105786 AATGATCTCTATGTGTATGAGGG + Intergenic
1123480295 15:20624914-20624936 CCTGCTCACTAGGATTAAGATGG - Intergenic
1123637711 15:22375451-22375473 CCTGCTCACTAGGATTAAGATGG + Intergenic
1124814789 15:32979062-32979084 ACAGCTCTCTGGGAGCAAGAAGG + Intronic
1127343835 15:58073477-58073499 ACTGCTCTTAAGGAGTTTTACGG + Intronic
1129682427 15:77665370-77665392 ACTGCCCTCTAGCAGGATGTTGG - Intronic
1131094641 15:89647702-89647724 CCTGCCCTATAGGAGGATGAGGG - Exonic
1137478598 16:48832102-48832124 CCTGCTATCCAGGAGAATGAAGG + Intergenic
1138801302 16:60033332-60033354 ACTCCTCTCTAGAAGTAATAAGG + Intergenic
1143753523 17:9049620-9049642 ATTACTCTTTAGGACTATGAAGG + Intronic
1147393686 17:40124637-40124659 ACTGCAGTCTAGGGGTGTGATGG + Intronic
1148103789 17:45108588-45108610 GCTGCACTCTAGGAGAAGGAGGG + Exonic
1156110946 18:33726685-33726707 ACTGCTGTCTAATAGTATAAAGG - Intronic
1156159494 18:34342707-34342729 ACTGCTCTCTTGAGGTAGGATGG - Intergenic
931384531 2:61786191-61786213 AATGTTCTCTGGGAGTGTGAAGG + Intergenic
936689974 2:114874906-114874928 CCTTCTCTCTAGTAGTATAAGGG - Intronic
937185449 2:120036208-120036230 ACTGCTCTCTAAGAGTTTGGTGG - Intronic
939001067 2:136735283-136735305 ATTGCTATCTAGAAGTATGGGGG + Intergenic
939954399 2:148514511-148514533 AGTGCTCTCTAGGGGTTTAAGGG - Intronic
945967639 2:216205831-216205853 ACTGCTTAAAAGGAGTATGAAGG - Exonic
946267306 2:218557277-218557299 ACAGATCTTTAGGAGCATGACGG - Intronic
947711506 2:232318969-232318991 ACTGCACTCAAGGAACATGAAGG - Intronic
947721713 2:232373663-232373685 ACTGCTTTTCAGGAGTATGTGGG + Intergenic
1174705080 20:52647128-52647150 ACAGCACTCTAGGAGTAGGATGG - Intergenic
1176190407 20:63806587-63806609 TATGCTCTCAAGGAATATGATGG + Intronic
1176670756 21:9733541-9733563 ACTGCTCTCTCTGATAATGAAGG - Intergenic
1178016642 21:28354142-28354164 ACTTCTCTCTAGGAATAGCATGG - Intergenic
1178916138 21:36706431-36706453 ACTGCTCTCTTGGAGCACCAGGG - Intronic
1180525303 22:16253541-16253563 AATGATCACTAGGTGTATGAGGG - Intergenic
1183200879 22:36385511-36385533 ACTTCTCTCTCGTAGGATGAAGG - Intronic
1203237585 22_KI270732v1_random:20708-20730 AATGATCTCTATGTGTATGAGGG - Intergenic
1203290214 22_KI270735v1_random:29371-29393 AATGATCTCTATGGGTATGAAGG + Intergenic
952091417 3:29891357-29891379 ACTTTTCTCTAGGACTCTGAAGG + Intronic
953242502 3:41162081-41162103 AATGCTCTCTAGGAGTAAATGGG - Intergenic
953344491 3:42163841-42163863 AATGATTTCTTGGAGTATGAGGG - Intronic
955288748 3:57670724-57670746 ACTTCTCTATATGAGCATGAAGG - Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
961775961 3:129285765-129285787 ACTGCACTCTATGACTCTGATGG - Intronic
962347148 3:134626462-134626484 ACTGCTCTCTGGGAGGGTGCAGG + Intronic
963994483 3:151692229-151692251 ATTGCTCTCTGGGAGCAAGATGG - Intergenic
972773108 4:42216659-42216681 ACTGTTCCCTAGGTGTCTGACGG + Intergenic
976507936 4:85871168-85871190 ATTACTCTCTAGGGGTAGGAGGG + Intronic
980159820 4:129146873-129146895 AATGAACTCTAGAAGTATGAAGG + Intergenic
981523235 4:145686703-145686725 ATTGCTCTCAAGGACTATCAAGG - Intronic
981657516 4:147128525-147128547 ATTGTTCTTTTGGAGTATGAAGG + Intergenic
982673465 4:158349050-158349072 ACTGGTATCTAGGGGTTTGAGGG + Intronic
989476377 5:41878647-41878669 ACTTCTCTGTAGGCGAATGAGGG + Intergenic
995409904 5:111845001-111845023 ACTGGTCTCTGGGACTCTGAGGG + Intronic
996981139 5:129496543-129496565 TCTACTCTCTAGGGGTATGTAGG + Intronic
997748021 5:136316859-136316881 ACTACTATCTAGCAGTCTGAGGG - Intronic
997878074 5:137566709-137566731 ACTACTCTCTAGGAAGTTGAAGG - Intronic
998292744 5:140930521-140930543 ACTGCACTCAAGAAGTTTGAGGG - Intronic
1006043008 6:31270895-31270917 TCTGCTCTCTAGGACAATTAAGG - Intronic
1009802579 6:68559211-68559233 ACTGCCCTCTAGTAGTAACAGGG - Intergenic
1013088596 6:106877656-106877678 AGTGGTTTCTAGGAGTTTGATGG - Intergenic
1013724348 6:113075488-113075510 ACTGTTTTCTAGCTGTATGATGG - Intergenic
1016138528 6:140578535-140578557 ACTGCTCTTTATCAGGATGAGGG + Intergenic
1017906789 6:158761949-158761971 TCTGCTCTCTCGGGGTCTGAGGG + Intronic
1018068009 6:160137185-160137207 CCTGCTCCCTAGGAGGATGCTGG + Intronic
1019548036 7:1587767-1587789 ACTGTTTTCTAGGAGTCCGAGGG + Intergenic
1021970338 7:25959430-25959452 ACTCCTCTCTGGAAGTTTGAGGG - Intergenic
1026544958 7:71314087-71314109 ACTGTTCTCTACAAGAATGAAGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1032239123 7:130147775-130147797 ATTGCTCCCTGGGAGGATGACGG + Intergenic
1037602147 8:20406187-20406209 CCTGCTGTCTTGGAGTTTGAGGG + Intergenic
1039819602 8:41124218-41124240 ACTGCTCTCTTGGTCTAAGAAGG + Intergenic
1046781812 8:118223458-118223480 AATGTTCTGTAGGAGTATGGTGG + Intronic
1047342758 8:123998988-123999010 AATGCTGTCTAGGAGAGTGAAGG + Intronic
1050432232 9:5573706-5573728 CCTGCTCTCTAGGAGTCTAAGGG - Intergenic
1050600880 9:7249090-7249112 ACTGCTCTATGGGAGTATACTGG + Intergenic
1055214239 9:73839109-73839131 ACTTCTCTCCATGAGTATGCAGG - Intergenic
1055849215 9:80605314-80605336 ACTGCTCTCTAGTGGAATAAGGG - Intergenic
1056201879 9:84284812-84284834 ACTGCTCTCCACGTGGATGAGGG - Intronic
1058493639 9:105530022-105530044 AGTGCTCTCTAGGAGTTAGAAGG + Intronic
1059700087 9:116767447-116767469 TCTGTTCTCTAGGCGTATGCAGG + Intronic
1061275447 9:129567390-129567412 ACAGCTCTCTCGGAGCAAGATGG - Intergenic
1187548782 X:20280584-20280606 TCTGCTCTCTGGGAGCAAGACGG + Intergenic
1187866864 X:23730898-23730920 ACTGCCTCCTAGGAGAATGAAGG - Exonic
1191861952 X:65672958-65672980 ACAGCACTCAAGGAGTATAATGG - Intronic
1191918015 X:66222975-66222997 ACTGCAGTCTAGGAGTCTGGAGG + Intronic
1195522561 X:105848371-105848393 ACTTCTTTCTAGGAATCTGAAGG + Intronic
1197374017 X:125660101-125660123 ACTCCTCTCTATGACTATTAGGG - Intergenic