ID: 1099986028

View in Genome Browser
Species Human (GRCh38)
Location 12:89665409-89665431
Sequence CTGGGAGAGCAAAAGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099986028_1099986032 22 Left 1099986028 12:89665409-89665431 CCTACTTTCTTTTGCTCTCCCAG 0: 1
1: 0
2: 1
3: 41
4: 438
Right 1099986032 12:89665454-89665476 CCTATTCTATTGTTCTATTTAGG 0: 1
1: 0
2: 1
3: 24
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099986028 Original CRISPR CTGGGAGAGCAAAAGAAAGT AGG (reversed) Intronic
900307566 1:2018805-2018827 CGGGGAGAGGAAAAGCAGGTGGG - Intergenic
900795129 1:4703246-4703268 CAGGGACTGCAGAAGAAAGTGGG + Intronic
902840870 1:19073062-19073084 CTCGGAGACCAGCAGAAAGTGGG + Intergenic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
903961590 1:27061122-27061144 CGGGGAGAGCAAGAGACAGTGGG + Intergenic
906977550 1:50591783-50591805 CTGTTAGTGCAGAAGAAAGTCGG - Intronic
907335574 1:53697346-53697368 CTGGAATAGGAAATGAAAGTTGG - Intronic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
909516940 1:76521352-76521374 CATGGAGAGGAAAAGAAGGTGGG + Intronic
909540071 1:76781466-76781488 CTGGTAGAGAAAGAGAAAGCAGG - Intergenic
909741384 1:79033517-79033539 CTGGGAGACAAATACAAAGTGGG + Intergenic
910698619 1:90048580-90048602 CTGCCAGAGGCAAAGAAAGTGGG - Intergenic
910786830 1:91008086-91008108 CTGGGAGGGAAAAAGAGACTGGG + Intronic
911767059 1:101690237-101690259 CTGGGAGAGCAGAACAGAGAAGG + Intergenic
912520845 1:110243678-110243700 CAGGGAGAGAAAAAGCAGGTAGG + Intronic
912789365 1:112636728-112636750 GTGGGAGAGTGAAAGAAAGAAGG - Intronic
913212923 1:116596383-116596405 CAGGGAGAGCAAAAGAAGAGAGG + Intronic
914871030 1:151473823-151473845 TTGAGAGAGAAAAAGAAAGTAGG - Intergenic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
915784017 1:158587528-158587550 CAGGGTAAGCAAAAGAGAGTGGG + Intergenic
916269585 1:162926297-162926319 ATGGGAGAGCACAAGAAAGCTGG + Intergenic
917083963 1:171286689-171286711 TTGGCAGAGCCAAACAAAGTTGG - Intergenic
917454200 1:175171658-175171680 CACTGAGAGCAATAGAAAGTGGG + Intronic
917558133 1:176113767-176113789 GTGGGAGAGTTCAAGAAAGTGGG + Intronic
919079097 1:192848449-192848471 CTGGGGGAGCAAGAGGAAGCTGG + Intergenic
919850087 1:201666683-201666705 CTGGGGGAGAAAGAGCAAGTGGG + Intronic
920664585 1:207953147-207953169 CTTAGAGAGCAAAAGAAAAAAGG - Intergenic
921264157 1:213408592-213408614 CTGGAAGAGCAGATGATAGTTGG - Intergenic
922092680 1:222411950-222411972 TTGGGAAAGAAAAACAAAGTTGG + Intergenic
922350915 1:224733996-224734018 CTGGGTGAGTGAAAGAACGTAGG - Intronic
923058196 1:230445288-230445310 CTGAGAAAGAAAAACAAAGTTGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063563488 10:7150647-7150669 CGGACAGAGAAAAAGAAAGTGGG - Intergenic
1063794780 10:9501149-9501171 CTTGGAGAGAAACAGAAAATAGG - Intergenic
1064598833 10:16972942-16972964 TTGGCAGAGAAAAAGAAAGATGG - Intronic
1066135874 10:32445957-32445979 TTGGGAGAGAATAAGAAAGGAGG + Intergenic
1066162132 10:32745464-32745486 GTGAGGGAGCAAAAGAAAGATGG + Intronic
1067004080 10:42644825-42644847 CTGGGAGAGCTAAAAGAAGCTGG + Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067213725 10:44282942-44282964 CTGGCAAAGTAAAAGAAAGCTGG - Intergenic
1068054080 10:51989210-51989232 GTGGAAGAGGAAAAGTAAGTAGG + Intronic
1068363888 10:56018425-56018447 GTGGGAAAGAAAAACAAAGTTGG + Intergenic
1069517302 10:69088133-69088155 CTGGGAGAGCTAGACTAAGTTGG + Exonic
1069661830 10:70128011-70128033 CTGGCAGAGCCAAAGAGAGTCGG - Intronic
1072070808 10:91914872-91914894 CTGAGAAAGTAAAACAAAGTTGG - Intergenic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1074564005 10:114560067-114560089 CTGGGAGAGCTTAAGAAAACTGG + Intronic
1074936813 10:118190157-118190179 GTGGGAGAGAAAAAGTAAGAAGG + Intergenic
1075291254 10:121232994-121233016 GTTGGAGAGCTTAAGAAAGTAGG + Intergenic
1075592909 10:123705396-123705418 CTGGGAGGGCAAAACCAAGAAGG - Intergenic
1075804269 10:125174135-125174157 GTGGGACAGCAAAAGGAAATTGG - Intergenic
1077150745 11:1072096-1072118 CTGGGGGAGCCAAAGACAGCAGG - Intergenic
1077496744 11:2890340-2890362 CTGTGAGGGCACAAGAAAGCAGG + Intronic
1078019366 11:7642438-7642460 CAGGGAGATCAAAGGAAAGTGGG - Intronic
1078511341 11:11986400-11986422 TGGTGAGAACAAAAGAAAGTAGG + Intronic
1080257673 11:30309460-30309482 CTGGCTGAGAAAAAGAAAGAAGG - Intergenic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1081445819 11:43130643-43130665 CTGGGAAAGGAGAACAAAGTGGG + Intergenic
1081547259 11:44080220-44080242 ACGGGAAAGAAAAAGAAAGTGGG + Intronic
1081682699 11:45019371-45019393 CTGGGAGAGGAAAGGGCAGTCGG + Intergenic
1083507185 11:63168710-63168732 CAGGGAGAATAAAAGCAAGTTGG + Intronic
1083880049 11:65543883-65543905 CTGCATGAGCAGAAGAAAGTGGG - Intronic
1086607492 11:88713575-88713597 CTGGGAGAGTAAAAGAAGATGGG - Intronic
1087026340 11:93653541-93653563 AGGGTAGAGAAAAAGAAAGTGGG + Intergenic
1087220027 11:95536818-95536840 ATGGCAGAGCAATAGAAAGGAGG - Intergenic
1087452400 11:98341978-98342000 GTGGGAGAGGAAAAGTAAGAGGG - Intergenic
1088200708 11:107330566-107330588 AAGGGAGAGAAAAAGACAGTAGG - Intronic
1089196035 11:116694546-116694568 ATGGGAGAGAGAAAGAAAGAAGG + Intergenic
1089318047 11:117605509-117605531 GTGGCAGAGTAAATGAAAGTTGG - Intronic
1089766228 11:120767988-120768010 CTGAGAAAGAAAAAGAAAGTTGG - Intronic
1090031471 11:123210135-123210157 AGAGCAGAGCAAAAGAAAGTTGG + Intergenic
1090244624 11:125207058-125207080 GTGGGAGAGTAAGAGAAAGGAGG + Intronic
1090609922 11:128461917-128461939 CTGGGAGGGCAAAAAAGAGGTGG - Exonic
1090686874 11:129131520-129131542 CTTGGAGAGCCAGAGAATGTGGG + Intronic
1090686952 11:129132150-129132172 CTTGGAGAGCCAGAGAATGTGGG + Intronic
1090840186 11:130480665-130480687 CTGGGATAGGAAAAGACTGTTGG + Intergenic
1091929956 12:4388093-4388115 CTGGGAGAGCAAGTGCAAGAGGG - Intergenic
1093770024 12:23007325-23007347 GTGGGAGAAAAAAAGAAAGATGG + Intergenic
1095421533 12:42029072-42029094 TTGGGAGAGCAAAAGGAAAAAGG - Intergenic
1095513266 12:42976919-42976941 CTAGGAGAAAAAAAAAAAGTGGG - Intergenic
1095971286 12:47903680-47903702 GGGGGTGAGCAAAAGAAATTAGG - Intronic
1096365896 12:51027898-51027920 CTCGGGGACCAAAAAAAAGTGGG + Intronic
1096609368 12:52790877-52790899 TTGAGAAAGCAAGAGAAAGTGGG + Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1097102009 12:56596500-56596522 CTGGGAGAGGAACACAAAGCAGG + Exonic
1097242368 12:57584195-57584217 CTGGGAAAGAAAGAGAAAGAGGG - Intronic
1097707768 12:62885367-62885389 CTAGGACAGCAAAAGAGGGTTGG + Intronic
1098078076 12:66755064-66755086 CTAGTAAAACAAAAGAAAGTGGG + Intronic
1098897856 12:76084090-76084112 CTGGGAGATGAAAAGAACGGCGG - Intronic
1099682502 12:85845545-85845567 CTTTGAGAGCAATAGAAAGCAGG + Intergenic
1099810928 12:87581124-87581146 CTTGGAGAGATAAAGAAACTTGG + Intergenic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1100005701 12:89892487-89892509 CATGGAGAGGATAAGAAAGTTGG + Intergenic
1100593121 12:96047834-96047856 TTGGCAGAGCAAGAGAAACTGGG - Intergenic
1100622290 12:96289711-96289733 ATGGTATAGCAAATGAAAGTTGG - Intronic
1101284901 12:103301780-103301802 CTGCGAAAGCAAAACAAAGAGGG + Intronic
1101737651 12:107475005-107475027 CTGGGAGAGCCAAAGAAACCAGG - Intronic
1102541616 12:113623764-113623786 CTGGGACAGAAAAAGAACATTGG - Intergenic
1102565330 12:113793837-113793859 CTGAAAGAGCAAAACAAGGTGGG - Intergenic
1102643142 12:114383965-114383987 ATGGGATAGGAACAGAAAGTTGG + Intronic
1102956867 12:117064611-117064633 CTAGGAGAGCACAAAAAAGATGG + Intronic
1103089038 12:118084495-118084517 TAGGGAGATCAAGAGAAAGTCGG - Intronic
1103176167 12:118865410-118865432 CTGGGATAGGAAAACAAAGAAGG - Intergenic
1103488974 12:121302241-121302263 CTGGGAAAGGAAAAGAAATCTGG + Intergenic
1104189456 12:126465362-126465384 CTTGCAGAGAAAAAGAAATTAGG + Intergenic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104823253 12:131690777-131690799 CTGGGAGAGTAAAAGGCCGTTGG + Intergenic
1105216165 13:18286982-18287004 CAGGGAGAGCAAAAGAAGAGAGG + Intergenic
1105717247 13:23079809-23079831 CTGGGAAGACAAAACAAAGTGGG + Intergenic
1106600119 13:31180440-31180462 TCTGGAGAGCAACAGAAAGTTGG - Intergenic
1106662277 13:31811976-31811998 GTGAGAGAGCAAAAGAAAAAGGG - Intergenic
1106780748 13:33056914-33056936 CTGGGAGAGAAGGAGAGAGTCGG - Intronic
1107819728 13:44275509-44275531 ATGGGAGAGAAAAAGAAAACAGG - Intergenic
1107864812 13:44693334-44693356 CTAGGAGAGGAAAAGGCAGTGGG - Intergenic
1107959790 13:45547818-45547840 CTGGGAGATCCAAAGAACCTAGG + Intronic
1108316345 13:49241166-49241188 TTGGGAGAACAAGGGAAAGTGGG + Intergenic
1109586628 13:64412758-64412780 TTGTGAGATCAAAAGAAAATTGG - Intergenic
1110948747 13:81458154-81458176 CTTTGAGAGGAAAAGAAATTAGG + Intergenic
1111420667 13:88006061-88006083 CTGGGAGGAAAAAAGAAAATGGG - Intergenic
1112048230 13:95618616-95618638 CGGGGAGAGAAAAAGAAACTGGG - Intronic
1112481374 13:99778803-99778825 CTGGGTGAGGCCAAGAAAGTAGG + Intronic
1114183506 14:20383672-20383694 GTGGGAGAGAAAAAAAAAGCAGG + Intronic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1116428571 14:44820161-44820183 CATGGAGAGCAAAGAAAAGTAGG + Intergenic
1117106531 14:52402726-52402748 CTGGTGGAGGAAGAGAAAGTAGG + Intergenic
1117419940 14:55534326-55534348 CTGGGACAGAAATAGAAATTTGG + Intergenic
1117461495 14:55949666-55949688 CTGAGAAAGAAAAACAAAGTTGG + Intergenic
1119103308 14:71900393-71900415 CTGGGAGACCAAAAGCCAGTAGG - Intergenic
1119886565 14:78148490-78148512 CTGGGAGAGCAGAAGCGAGAAGG + Intergenic
1120579538 14:86228793-86228815 CTGGAAGAGCAGAACAAAGTTGG - Intergenic
1120736809 14:88062447-88062469 TCAGGAGAGCAAAAGAAGGTGGG + Intergenic
1121821205 14:96968014-96968036 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1122253130 14:100454549-100454571 ATTGGAGAGCAAAAAAAAGCAGG + Intronic
1122987487 14:105219233-105219255 CTGGGCGAGCACAGGGAAGTGGG + Intronic
1123953531 15:25309917-25309939 CTTGGAAGGCAGAAGAAAGTGGG - Intergenic
1124394078 15:29285354-29285376 CTGAGAGAGCACAAGAAAGCTGG - Intronic
1124554665 15:30713203-30713225 ATGTGGGAGCAAAAAAAAGTGGG - Intronic
1124676583 15:31692477-31692499 ATGTGGGAGCAAAAAAAAGTGGG + Intronic
1125413674 15:39430515-39430537 CTGGGAGAGGGAATAAAAGTTGG - Intergenic
1125878903 15:43175237-43175259 CTGAGAGAGTAACACAAAGTAGG + Intronic
1126075586 15:44905993-44906015 CTGGCAAAGAAAAAGAAAGAAGG - Intergenic
1126677407 15:51172330-51172352 CGGGGAAAGGAAATGAAAGTTGG + Intergenic
1127169780 15:56289610-56289632 CTATGAGAGCAAAAGAAACCAGG - Intronic
1127365370 15:58284428-58284450 CTGGGTGAGCAAAGGTGAGTTGG + Intronic
1128713726 15:69891721-69891743 CTGGGTGATCACATGAAAGTAGG - Intergenic
1129273624 15:74432269-74432291 CTGGGAGGGCAAAGGAAGCTTGG + Intronic
1129912894 15:79242829-79242851 CTGGGAGAGGACAGGAATGTGGG - Intergenic
1131590766 15:93746544-93746566 CAGGGAGAGCAAACAAAAGCAGG + Intergenic
1132004771 15:98217240-98217262 CTGGGAGAGGAAAAGCAACACGG + Intergenic
1133178098 16:4031470-4031492 CTGAGACAGCCAAAGAAATTTGG + Intronic
1134316907 16:13127183-13127205 GTGGGAGAGAGAAAGAAAGAGGG + Intronic
1134467656 16:14493628-14493650 CTGGTAGAGCAACACCAAGTAGG + Intronic
1134892564 16:17853991-17854013 ATGGGAGAGGAAAAGAGAGGAGG + Intergenic
1136458344 16:30395107-30395129 CTGGGAGAGACAAAGAAAGAGGG - Exonic
1136915342 16:34186877-34186899 CTGGTCAATCAAAAGAAAGTTGG + Intergenic
1136915433 16:34188588-34188610 CTGGTCAATCAAAAGAAAGTTGG + Intergenic
1137420696 16:48331216-48331238 CTCAGAGTGGAAAAGAAAGTAGG - Intronic
1137471293 16:48761027-48761049 AAGGGAAAGCAAAAGAAAGCAGG + Intergenic
1137517622 16:49161771-49161793 CTAGGATAGCAACAGAAAATAGG - Intergenic
1138109997 16:54316160-54316182 GGGGGAGAGCAGAAGAAAGCAGG - Intergenic
1139875879 16:70145546-70145568 CTGGGAGAGCAAACGCTGGTGGG - Intronic
1140359908 16:74335552-74335574 CTGGGAGAGCAAACGCTGGTGGG + Intergenic
1147747276 17:42702523-42702545 CTGGGAGGGCTAAAGGACGTCGG + Exonic
1147873709 17:43605907-43605929 CTGGCTGAGCAAAAGAAAGAAGG - Intergenic
1148638794 17:49169491-49169513 GAGGGAGAGCAGAAGGAAGTGGG - Intronic
1148910496 17:50939929-50939951 CTGGGAGCGGAAGAAAAAGTAGG - Intergenic
1149018587 17:51937100-51937122 AAGGGAAAGCAAATGAAAGTTGG + Intronic
1149324242 17:55513585-55513607 CCGAGTGGGCAAAAGAAAGTAGG - Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1150179155 17:63096870-63096892 ATAGGAGAACAAAAAAAAGTTGG - Intronic
1150436917 17:65161163-65161185 TTGGGATGGCAAAAGGAAGTGGG - Intronic
1150453476 17:65288558-65288580 CTGGGAGATCAGTAGAATGTAGG - Intergenic
1151002206 17:70390717-70390739 CTGGGTGAGCCAAACAAAATAGG - Intergenic
1152962631 18:88906-88928 CTGGGGGAGCACTGGAAAGTTGG + Intergenic
1154248997 18:12727041-12727063 CTGGGAGAGAAAATGCAAGTTGG - Intergenic
1154443185 18:14411272-14411294 CAGAAAGAGCAAAAGAATGTGGG - Intergenic
1155757661 18:29521692-29521714 CAGAGAGAGCAAATCAAAGTTGG - Intergenic
1156372790 18:36486216-36486238 CTGGGAGAGGAGAAGCCAGTTGG - Intronic
1157067801 18:44372719-44372741 CAGGGAGAACAAAACTAAGTTGG - Intergenic
1157657770 18:49408780-49408802 CTGGGACAGCTAAAGAATTTAGG - Intronic
1158072144 18:53484728-53484750 CTGAGAAAGAAAAACAAAGTTGG - Intronic
1158114981 18:53985221-53985243 ATGAGAGAGCAAAAGAAAGCAGG + Intergenic
1158233090 18:55280554-55280576 CTTTGAGAGCAAAAGAAAATGGG - Intronic
1158793181 18:60807094-60807116 ATGGGAGAGTAAAAGAACCTAGG - Intergenic
1159177968 18:64863459-64863481 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1159225746 18:65532895-65532917 CTTGGGGAGCAAAAATAAGTTGG + Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164791983 19:30994606-30994628 TTGGGAAAGAAAAAGAGAGTAGG - Intergenic
1166324837 19:42042756-42042778 CTGGGTGGGCAGAAGAAAGCAGG + Intronic
1166378784 19:42343850-42343872 CTGGGATAGCTAAAGCAAGCGGG + Intronic
1166560929 19:43731854-43731876 CTGGGTGAGCTAAGAAAAGTTGG - Intronic
1167001985 19:46751008-46751030 CTAGGGGAGCAAAATAAAGCAGG + Intronic
1167236171 19:48317000-48317022 CTTGAAAAGAAAAAGAAAGTGGG + Intronic
1167508917 19:49885634-49885656 CTGGGAGACCAAAAAAAATTGGG + Intronic
1168369418 19:55819658-55819680 TTGGGGGCGAAAAAGAAAGTTGG + Intronic
925568304 2:5281122-5281144 CTGAGAAAGTAAAACAAAGTTGG + Intergenic
925650014 2:6080075-6080097 ATGAGAGAGAAAAATAAAGTAGG + Intergenic
926100096 2:10110051-10110073 CTGAGAGGGAAAAAGAAACTTGG - Intergenic
926911040 2:17852581-17852603 CACTGAGAGCAAGAGAAAGTGGG + Intergenic
928255246 2:29716596-29716618 CTGGGAGAAAAAATGAAAGTAGG + Intronic
929910404 2:46084879-46084901 CCTGGAGAGAAAAAGAAGGTCGG - Intronic
930249352 2:49018089-49018111 ATGGCAAAGAAAAAGAAAGTTGG + Intronic
930455581 2:51604477-51604499 CAGGGAGAACAAAACCAAGTTGG - Intergenic
930686372 2:54312785-54312807 GTGGGAGAGCAAAAGCATGATGG - Intergenic
930799080 2:55423747-55423769 CAGGGAGAGAAAGAGAAATTAGG + Intergenic
931069167 2:58625037-58625059 AGGGGAAAGCAAAAGAAACTGGG + Intergenic
931226400 2:60335618-60335640 CTGGGAGAGAAAATGACAGCGGG - Intergenic
931683720 2:64774215-64774237 CTGGGAAACCAAAATAAATTAGG - Intergenic
932914108 2:75836295-75836317 AATGGAGAGCAAAACAAAGTGGG + Intergenic
933774708 2:85765135-85765157 CAGGGAGAGCAACAGAGAGTGGG + Intronic
933872085 2:86576565-86576587 CTGGAAGAAGAAAAGAAAGAGGG + Intronic
934137375 2:89009795-89009817 CTGAGAAAGAAAAAGAAATTGGG + Intergenic
934298162 2:91759743-91759765 CAGGGAGAGCAAAAGAAGAGAGG - Intergenic
935494869 2:103768422-103768444 CTGAGATTGCAAAAGAAATTAGG - Intergenic
935495140 2:103771542-103771564 CTGGGAGAGCAAAACATAGAAGG + Intergenic
935518547 2:104076520-104076542 CTGGAAAAGCAAAAGAATGGAGG - Intergenic
935852937 2:107242865-107242887 CTGGTGGCTCAAAAGAAAGTAGG + Intergenic
936955471 2:118017909-118017931 ATGGGTGAGCAAAAGAACATGGG - Intergenic
937750604 2:125472344-125472366 ATGGGAGAGGGAAAGAAACTAGG + Intergenic
937763171 2:125629693-125629715 CTGGGAAAACAAAAGAAACAAGG + Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938114229 2:128592376-128592398 CTGGGAGAAGAAAGAAAAGTGGG + Intergenic
939837063 2:147142949-147142971 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
940058076 2:149534491-149534513 GTGGGAGAGCAATAGAGAGAGGG - Intergenic
941061977 2:160857221-160857243 CTGGAATAGAAAAAGACAGTAGG - Intergenic
941063025 2:160869324-160869346 ATGGGAGAGAAAAAGAGACTGGG - Intergenic
942475647 2:176317219-176317241 GAGGGAGAGAAAAAGAAAGGAGG - Intronic
942758668 2:179372290-179372312 CTGGGAAATCAAAAGGGAGTTGG + Intergenic
942783982 2:179678544-179678566 ATATCAGAGCAAAAGAAAGTAGG + Intronic
943162792 2:184277337-184277359 CTGTCACAGCAAAAGAAAGATGG + Intergenic
943235951 2:185319807-185319829 CTTGAAGATCAAATGAAAGTAGG + Intergenic
943688292 2:190842591-190842613 CTGTGAGAGAAAAATAAGGTAGG - Intergenic
944674061 2:202020392-202020414 CTGGGAGACCCACAGAAAGCTGG - Intergenic
945338997 2:208629006-208629028 CTTGAAGAGCAAAACAAAGTGGG - Intronic
946437626 2:219668415-219668437 ATGGAAGAGCAAAAGGAAGCCGG - Intergenic
947181219 2:227413171-227413193 CTTGGAGAGCAAGTGAAAGAGGG + Intergenic
947243979 2:228026601-228026623 CAGGGAGGGCCAAAGCAAGTTGG - Intronic
947356072 2:229296844-229296866 CTGGCAGAGCAAAAGAAGAGGGG + Intergenic
948342214 2:237262899-237262921 CAGGTAGAGCAAAGGAAAATGGG + Intergenic
1168968033 20:1911820-1911842 CTAGGAGGGCAAGAGAAAGCAGG + Intronic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1170745053 20:19091665-19091687 CTGGTAGGGGAATAGAAAGTGGG - Intergenic
1171317068 20:24204649-24204671 CTGGGGGAACCAAAGACAGTTGG + Intergenic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1173082056 20:39877726-39877748 CTGGGAGAGGAAAGAAAAGTGGG - Intergenic
1173426410 20:42947210-42947232 ATGGGAGAGATAAAGAAATTTGG + Intronic
1173435947 20:43032397-43032419 CTGGGGGAGCAAAAGAGCCTCGG + Intronic
1174611760 20:51802778-51802800 CTTGGAGAGGAAAAGAAAATGGG + Intergenic
1175659696 20:60802027-60802049 CTGGGAGAGCAACAGCCAGCCGG - Intergenic
1175707120 20:61188048-61188070 GTGGGAGCGCAAGAGAAACTCGG + Intergenic
1176378069 21:6096597-6096619 CTGGGAGAGCAACAAAGTGTAGG - Intergenic
1176452909 21:6879931-6879953 CAGAAAGAGCAAAAGAATGTGGG + Intergenic
1176831082 21:13744979-13745001 CAGAAAGAGCAAAAGAATGTGGG + Intergenic
1176963886 21:15190240-15190262 CTGCAATGGCAAAAGAAAGTTGG - Intergenic
1177172764 21:17671967-17671989 CTGGGAGAGCATGAGCAAGTGGG - Intergenic
1177693895 21:24546650-24546672 CTAGAAGAGCAAAGGAAAGGTGG + Intergenic
1178321783 21:31611359-31611381 CTGGGAGGGCAAAAGAATGAAGG + Intergenic
1179599825 21:42469583-42469605 GTGGGAGTGCAGAAGAAATTAGG + Intergenic
1179745404 21:43441649-43441671 CTGGGAGAGCAACAAAGTGTAGG + Intergenic
1180396383 22:12347698-12347720 CTGCCAAATCAAAAGAAAGTTGG + Intergenic
1180403330 22:12516392-12516414 CTGCCAAATCAAAAGAAAGTTGG - Intergenic
1181176105 22:21037026-21037048 CTGGGAGAACAAATAAAAGCGGG + Intergenic
1184195531 22:42925091-42925113 TTGGGAGAGAAAAATAAAGCAGG - Intronic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949740872 3:7232221-7232243 CTGAGTGAGCAAAAAAATGTTGG - Intronic
950013768 3:9742197-9742219 CTGGGAGAGGAACAGAGAGAAGG - Intronic
950642716 3:14358877-14358899 CTGGAAAAGCAAAGCAAAGTGGG - Intergenic
950830915 3:15875408-15875430 CTGAGAGAGGAAGACAAAGTGGG - Intergenic
951115249 3:18853479-18853501 CTGGGAGACCAAAAGATGGGGGG + Intergenic
951224967 3:20110363-20110385 CTGGGAGATAAAAAAAAAATAGG + Intronic
951420464 3:22478182-22478204 CTGTGAAAGCAAAATAAGGTAGG - Intergenic
952489381 3:33851796-33851818 CTGGGAGAGGAAAAGGAAAGAGG - Intronic
953381207 3:42474070-42474092 CAGAGAGATCATAAGAAAGTGGG + Intergenic
953476204 3:43207921-43207943 CTAGGCAAGCAGAAGAAAGTAGG - Intergenic
953677137 3:45011737-45011759 CTGGGAGAGGAAAAAAGAGGAGG + Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
956192711 3:66622488-66622510 CAGAGAGAGCAGAGGAAAGTGGG - Intergenic
957660341 3:83143356-83143378 CTGGAAGATCAAAAGCAAGGTGG - Intergenic
957963939 3:87297490-87297512 CTGGGGCAGAAAAATAAAGTAGG - Intergenic
958132447 3:89445646-89445668 GTGGGAAAGCATAAGGAAGTGGG - Intronic
958779480 3:98523355-98523377 CTGGGAGAGGGAAATAAAATGGG - Intronic
958802160 3:98768726-98768748 CTGGGAAGTCAATAGAAAGTAGG - Intronic
958846354 3:99269614-99269636 CTGTGAGAGCCACAGAAAGCTGG - Intergenic
960759945 3:121062605-121062627 TGGGGAGAACAGAAGAAAGTTGG - Intronic
961259984 3:125594743-125594765 CTCGGAGAGCGAAGGAAAGCTGG - Exonic
961718872 3:128879026-128879048 TTGGAAAAGGAAAAGAAAGTGGG - Intergenic
962243371 3:133770469-133770491 GTGGGAGAGAAAAAAAAAGGCGG - Intronic
963744836 3:149115618-149115640 TTGGGAGAGCAAATGGAGGTGGG - Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
964090279 3:152867887-152867909 CTAGAAGGGCAAAAGAAACTTGG + Intergenic
965631109 3:170733974-170733996 CTCTGACAGCAAAAGAAAGCAGG + Intronic
966138086 3:176723738-176723760 CTGGGAATGGAAAAGAGAGTAGG - Intergenic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
967757534 3:193186907-193186929 CTGGGTTCTCAAAAGAAAGTCGG - Intergenic
967843482 3:194026200-194026222 CAGAGAGAGCAAAGGAAACTGGG + Intergenic
967878579 3:194282979-194283001 CTGGGAGAGCCAGACACAGTGGG + Intergenic
969104215 4:4792838-4792860 CTAAGAAAGAAAAAGAAAGTAGG - Intergenic
969130704 4:4989291-4989313 CTGAGACAGCAAAAGAAAGAAGG - Intergenic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
970200656 4:13601257-13601279 CTGGAAGAGGAAATGAAATTGGG - Exonic
970542168 4:17091075-17091097 CTGAGGGAAAAAAAGAAAGTTGG + Intergenic
970964192 4:21909135-21909157 CTGGGAGAGAAAAAGAGAATAGG + Intronic
971571882 4:28222826-28222848 CAGGAAGAACAAAAGAGAGTGGG - Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
972675454 4:41256316-41256338 CTGGGAGAGCAGTAGAAAGCTGG - Intergenic
973115785 4:46456789-46456811 TTGGAAGACCAGAAGAAAGTGGG + Intronic
973144518 4:46807964-46807986 CTGAGAAAGAAAAACAAAGTTGG - Intronic
974464938 4:62242942-62242964 CAGAGACAGCAAAAGAAACTTGG - Intergenic
974858974 4:67496709-67496731 CAGGGAAAGGAAATGAAAGTCGG + Intronic
975058559 4:69967589-69967611 CTGGTATAGCAAAAGGAAATAGG + Intergenic
975911714 4:79274916-79274938 CTTGGAAAGCAAAAGAAAAAAGG - Intronic
976960538 4:90966413-90966435 CAGGGAGGCCAGAAGAAAGTGGG + Intronic
977768746 4:100831576-100831598 ATGGGAGGGCAAAAGAAAATAGG + Intronic
979654461 4:123175999-123176021 GGGGGAGAGCTTAAGAAAGTGGG + Intronic
979853058 4:125597251-125597273 CTGGAAGAGCAAAAGATTTTGGG - Intergenic
980041715 4:127947679-127947701 AGGGGAGAGCAAAAGAAAGATGG + Intronic
981009765 4:139913628-139913650 CTGTGAGAGCAAAAGAACCAAGG + Intronic
981414630 4:144477630-144477652 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
982031320 4:151303922-151303944 ATGAGAGAGCAAGAGAAGGTAGG - Intronic
984079038 4:175219840-175219862 CTGAGAAAGAAAAAGAAAGCTGG - Intergenic
984382134 4:179008034-179008056 CTAGGAGTGCAGAAGAAAGCTGG + Intergenic
984651121 4:182271572-182271594 CTGGGAGAGAAAGAAACAGTGGG + Intronic
984957842 4:185063445-185063467 CTGTGTGAGTAAAAGAAACTTGG - Intergenic
985299531 4:188473219-188473241 CTGAGAGAGAAAGAGAAAGAGGG - Intergenic
987393133 5:17395801-17395823 CTGGGATAGAAAAAGACATTAGG - Intergenic
987550452 5:19373194-19373216 ATGAGAGAGCAAGAGAAAGAAGG + Intergenic
987979770 5:25067803-25067825 CTGGGTGATTAAAAAAAAGTAGG - Intergenic
988477694 5:31601860-31601882 CTGAGAGAGGAAGAGAGAGTTGG + Intergenic
988829805 5:34976516-34976538 CTGGGACAAAAAAAGAGAGTTGG + Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990487046 5:56269521-56269543 CTGGCAGAGAGAAAGAAAGCAGG - Intergenic
990746873 5:58967551-58967573 ATTGGAGAGCAAAAGAAGGAAGG + Intergenic
990809269 5:59703950-59703972 CAGAGAGAGTAAAAGAAAGAGGG + Intronic
992225716 5:74618321-74618343 CGGGGAGAGCCAGAGAAGGTAGG + Intergenic
993072415 5:83181951-83181973 CTGGGAGAGCCAAAACAAGTAGG + Intronic
993201350 5:84819243-84819265 CAGGGAGAGAAAAAGAAAGAGGG - Intergenic
993215305 5:85015037-85015059 CAGGTAAAGCAAAAGAAAGAAGG + Intergenic
994178146 5:96734465-96734487 CTGTGATAGAATAAGAAAGTGGG + Intronic
995610411 5:113903603-113903625 CTGGGAGAGAAATAGAGAATAGG + Intergenic
996829862 5:127728087-127728109 CGGGGAGAACAAAACCAAGTTGG + Intergenic
996853749 5:127981523-127981545 TTGGGAGAGAAAAGGAAAATAGG + Intergenic
997403273 5:133619285-133619307 CAGGGAGAGAAAAAGAACCTAGG + Intergenic
997439039 5:133896352-133896374 GTGAGAGAGGAAAAGAATGTGGG + Intergenic
997632852 5:135382797-135382819 TTGGGAGAGCAGAGGAAAATGGG + Intronic
997654820 5:135546918-135546940 CTTGGTGAGAAAGAGAAAGTTGG + Intergenic
998388111 5:141769844-141769866 ATGGGGGAACAAAAGAGAGTGGG + Intergenic
998668420 5:144325522-144325544 CTGGGAGAGCACATGACAGTAGG - Intronic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
1000383940 5:160655923-160655945 CTTTGAGAGCGAAGGAAAGTGGG + Intronic
1001020522 5:168178631-168178653 CAGGGAGAGGAAAAGAAGGAAGG + Intronic
1001067162 5:168545125-168545147 CTGGGAGAGAAAGAGAGATTGGG + Intergenic
1002261149 5:177994918-177994940 CTGGCAGTGCAATAGGAAGTGGG - Intronic
1002401303 5:178992857-178992879 CAGGGAGAGAGAAAGAAAGAGGG + Intronic
1002758569 6:184117-184139 CTGGAAGAGCAAAAGAAATCGGG - Intergenic
1002934190 6:1657756-1657778 CAGGGAGAGAGAAAGTAAGTGGG - Intronic
1004393380 6:15227687-15227709 CTTGGGGAGGAGAAGAAAGTAGG - Intergenic
1005611580 6:27530281-27530303 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1005672701 6:28123330-28123352 CTGAGTGAGCAAAAGAGCGTTGG - Intergenic
1005996253 6:30933211-30933233 TGGGGAGAGCAAAAGCAAGATGG + Intergenic
1006739830 6:36300048-36300070 CTGGAACAGAAAAAGAAATTAGG - Intronic
1006747521 6:36354599-36354621 CTTGGAAAGAAAAACAAAGTTGG - Intergenic
1007234130 6:40378313-40378335 CTGCCAGAGCAGAAGACAGTTGG + Intergenic
1007567338 6:42862366-42862388 CAGGGAGAGGCAAAGAAAGGAGG + Intronic
1007948184 6:45844677-45844699 CTGGTAAACCAAGAGAAAGTGGG - Intergenic
1008036001 6:46745803-46745825 CTGGCAGAGCAGAAGAAATCAGG - Intergenic
1008298631 6:49807048-49807070 CGGGGAGAACAAAACCAAGTTGG + Intergenic
1008879592 6:56367570-56367592 ATGGCAGAGCAGCAGAAAGTAGG + Intronic
1010006951 6:71006054-71006076 CTGAGAAAGAAAAATAAAGTTGG - Intergenic
1010063709 6:71655504-71655526 ATGGGAGAGCAGCAGAAAGTGGG - Intergenic
1010473041 6:76252299-76252321 CTGGGAGTGCAAGAGAGAGCAGG + Intergenic
1011471959 6:87717044-87717066 GTGGGAGAGAAAAAGAAGGGTGG - Intergenic
1011488498 6:87867639-87867661 CTGGTAGAGCATAAGTAAGCAGG - Intergenic
1011853585 6:91661065-91661087 TTGTGGGAGAAAAAGAAAGTGGG + Intergenic
1012397900 6:98821116-98821138 CTGGGAGTGCCAAATAGAGTTGG - Intergenic
1012520941 6:100120425-100120447 CAGGGAGAGTGAGAGAAAGTGGG - Intergenic
1013279920 6:108626520-108626542 CAGGGAGAGAAAGAGAAAATCGG + Intronic
1014050897 6:116953198-116953220 CAGGGAGAGGAAAAAAAACTGGG - Intergenic
1014215386 6:118747956-118747978 CTGTTAGAGCAAAGGAAGGTAGG - Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1016336495 6:143011005-143011027 CTGGGAGAGGAAAAGAGCTTAGG + Intergenic
1018453375 6:163929860-163929882 CTGCTTGAGCAAAAGAAAGCAGG + Intergenic
1020290367 7:6718281-6718303 CTGGGACAGCAGAGGAAGGTGGG - Intergenic
1020509132 7:9030568-9030590 ATGGGAGAGCAGAAGAAATAAGG + Intergenic
1020511177 7:9059160-9059182 CTAGGAGAGCTTAAGAAGGTAGG - Intergenic
1020640322 7:10746602-10746624 CTGGGCAAGAAAAACAAAGTGGG + Intergenic
1021815490 7:24443448-24443470 CTGAGAGAGAAAAAGGAATTTGG - Intergenic
1022025748 7:26446086-26446108 CTGGGAGAGGATCACAAAGTGGG + Intergenic
1022114917 7:27252849-27252871 TTGGGAGAGCGAAAGAGAGTGGG + Intergenic
1023045996 7:36210633-36210655 CTGGGAGAGCAAGAGAGTGAGGG - Intronic
1023448931 7:40260973-40260995 CTGAGATAGAAAAAAAAAGTGGG - Intronic
1023625272 7:42109162-42109184 CTGGGAAAACAAAAGATTGTAGG - Intronic
1023803006 7:43851082-43851104 CTGGGTCAGCACAAGAAAGGTGG - Intergenic
1023913165 7:44569433-44569455 TTGGGAGAGGAGAAGAGAGTGGG - Intronic
1024396813 7:48879006-48879028 CTGGGTGAGTAACAGGAAGTAGG - Intergenic
1025092721 7:56077011-56077033 CTGGTAAAGCAAAAGACAATGGG + Intronic
1025683654 7:63699369-63699391 CTGGGAGTGCAAAGGACAGATGG - Intergenic
1026907486 7:74070882-74070904 CTGGGAGGGAAAGAGAAAGCTGG + Intergenic
1027240565 7:76325265-76325287 CTAGGAGACCATAAGAAACTAGG - Intergenic
1027487980 7:78785990-78786012 CTGGGAGAGAAACAGAGAGGAGG + Intronic
1027601795 7:80248625-80248647 CTGGGAGAGCAAGAGAATCCTGG + Intergenic
1028482445 7:91322335-91322357 ATGGTAGAGTAAAACAAAGTGGG + Intergenic
1029018798 7:97342258-97342280 GAGGGAGAGAAAAAGAAAGAAGG - Intergenic
1029538322 7:101168777-101168799 CTGGGAGAGAAAGAGAGAGCAGG + Intergenic
1029740973 7:102491444-102491466 CTGGGACTACAAAAGCAAGTTGG - Intronic
1029758967 7:102590617-102590639 CTGGGACTACAAAAGCAAGTTGG - Intronic
1029788971 7:102822557-102822579 CTGTGACAGTAATAGAAAGTGGG - Intronic
1030655164 7:112159562-112159584 CTGTTAGAGCAAAAGAAATACGG - Intronic
1030953801 7:115825538-115825560 CTGGGATAGGGAAATAAAGTAGG - Intergenic
1030972272 7:116075419-116075441 CTGAGACAGCAAAAAAATGTGGG + Intronic
1031073461 7:117189298-117189320 CTGTTGGAGAAAAAGAAAGTAGG - Intronic
1032321972 7:130894185-130894207 CAGAGAGAGCAAAGGAAACTCGG - Intergenic
1033247036 7:139726386-139726408 ATGTGAGAGCAAAGGAAAGAGGG + Intronic
1033615713 7:143012296-143012318 ATGGGGGAGCAAAAGAAGGGTGG - Intergenic
1033779624 7:144653110-144653132 TTTGGAGAGCAACATAAAGTCGG - Intronic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036670381 8:10780903-10780925 CTGAGAGAGAAAAACAAAGCTGG + Intronic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037593578 8:20334701-20334723 CTGGGAGAGGGAGAGAAAGCCGG + Intergenic
1039656013 8:39408195-39408217 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG + Intronic
1040845456 8:51833224-51833246 CTGGGTAAGCAAAACAAAGGAGG + Intronic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1042088048 8:65130206-65130228 CTGTGAGAAAAAAAAAAAGTCGG - Intergenic
1042638652 8:70907493-70907515 CAGGGAAAGAAACAGAAAGTGGG - Intergenic
1043656212 8:82670543-82670565 TTGGGAAAGAAAATGAAAGTAGG - Intergenic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1044752656 8:95431092-95431114 CTGGGAGAGAAAAAGTATCTAGG - Intergenic
1044843890 8:96361322-96361344 CTGGGAGAGCTAGAGAAGGATGG - Intergenic
1045856960 8:106775604-106775626 CTGAGAAAGAAAAACAAAGTTGG - Intergenic
1045895422 8:107210201-107210223 CTGGGAGACCAAGAGATATTTGG + Intergenic
1046301521 8:112298781-112298803 AATGGAGAGAAAAAGAAAGTTGG + Intronic
1046306180 8:112370487-112370509 ATGAGAGAGGAAAAGTAAGTGGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047947334 8:129894769-129894791 CTGGAAGAGCAAAAGGAACAAGG - Intronic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1052571744 9:30234044-30234066 CTGGGAGAAAACAGGAAAGTTGG - Intergenic
1054723654 9:68628369-68628391 CAGGTAAAGCTAAAGAAAGTGGG - Intergenic
1055210110 9:73781226-73781248 TTGGGAGAGAAAAAGTAAGGGGG + Intergenic
1055838151 9:80469768-80469790 CTAAGAAAGCAAAACAAAGTTGG + Intergenic
1056400763 9:86225123-86225145 CCGGGGGAGGAAAAGAGAGTGGG - Intronic
1057639729 9:96807129-96807151 CTGGGAAAGAAAGACAAAGTTGG + Intergenic
1058189549 9:101896160-101896182 CTCAGAGAGCAGAAGAGAGTAGG - Intergenic
1059138628 9:111831297-111831319 CTGGAAGCGCAAAATCAAGTTGG + Intergenic
1059285219 9:113166530-113166552 CTGAGAGAGCGAGAGGAAGTGGG + Intronic
1060010015 9:120035627-120035649 CAGGGAAAGGAAAAGAATGTAGG + Intergenic
1060544458 9:124452068-124452090 CTGGGAGAGAAGAAGACAGGTGG - Intronic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1061824022 9:133246796-133246818 CCGGGAGAGCAGAACACAGTGGG + Intergenic
1062735508 9:138135210-138135232 CTGGGGGAGCACTGGAAAGTTGG - Intergenic
1203516272 Un_GL000213v1:4584-4606 CAGAAAGAGCAAAAGAATGTGGG - Intergenic
1185820387 X:3197370-3197392 CTTAGAGGGCAAAGGAAAGTTGG + Intergenic
1186208456 X:7224883-7224905 CAGAAAGAGCAAAATAAAGTTGG - Intronic
1186432493 X:9517053-9517075 CTGGGAGAGCAGAAGAAACGTGG + Intronic
1186651780 X:11569084-11569106 CTAGTAGAGCAGAAGAAAGAGGG + Intronic
1189130124 X:38489896-38489918 CAGGGAGACCAAAACAAAGTGGG + Intronic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1193238280 X:79135614-79135636 CTGTGAGAGAAAAAAATAGTAGG - Intergenic
1193271907 X:79538234-79538256 CTGGGAAATCAAAATCAAGTAGG - Intergenic
1193390168 X:80917004-80917026 CTGAGAAAGAAAAACAAAGTTGG + Intergenic
1193673381 X:84417486-84417508 CTGGGAGAGGGAAAGAGAATGGG + Intronic
1193808434 X:86022021-86022043 CTGGAAGAGCAGTAGAAAATAGG + Intronic
1194046102 X:89005423-89005445 GTTGGAGAGCAAAAAAAAATAGG - Intergenic
1194334162 X:92625251-92625273 CTGAGAGAGTAAAATAAAATGGG - Intergenic
1194805312 X:98319708-98319730 CTGGGAGAGCAACACACACTCGG - Intergenic
1196145635 X:112313918-112313940 AAGGGAGATCAAAAGGAAGTGGG + Intergenic
1196161068 X:112483164-112483186 CTGTGAAAGAAAAACAAAGTTGG - Intergenic
1196965569 X:121051165-121051187 GAAGAAGAGCAAAAGAAAGTGGG - Intergenic
1197838986 X:130725263-130725285 CTGGAAAAGCAATAGATAGTGGG - Intronic
1198059251 X:133027768-133027790 TTGAGATAGCAAAAGGAAGTGGG - Exonic
1198191713 X:134313875-134313897 CAAGGAGGCCAAAAGAAAGTAGG + Intergenic
1198729016 X:139707441-139707463 CTTGGAGAGCAAAGAAAAATGGG - Intronic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1200183802 X:154168623-154168645 CTGTTACAGCAACAGAAAGTGGG + Intergenic
1200189456 X:154205751-154205773 CTGTTACAGCAACAGAAAGTGGG + Intergenic
1200195209 X:154243560-154243582 CTGTTACAGCAACAGAAAGTGGG + Intergenic
1200200861 X:154280681-154280703 CTGTTACAGCAACAGAAAGTGGG + Intronic
1200642850 Y:5744245-5744267 CTGAGAGAGTAAAATAAAATGGG - Intergenic
1201676144 Y:16586715-16586737 CAGAGAGAGAAAAAGAAAGGGGG - Intergenic