ID: 1099986043

View in Genome Browser
Species Human (GRCh38)
Location 12:89665709-89665731
Sequence CCTTCTGTTCAGGAGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099986043 Original CRISPR CCTTCTGTTCAGGAGCTAGA AGG Intronic
900771078 1:4545421-4545443 CCTGCTGCTCAGGATCTGGAAGG - Intergenic
901081232 1:6585439-6585461 GTTTCAGTTCAGGAGCCAGAAGG - Intronic
901106757 1:6762409-6762431 ACTTCTGTTAGAGAGCTAGAAGG - Intergenic
903199350 1:21721099-21721121 CCAGCTGTTCAAGAGCTAGCTGG + Exonic
904850903 1:33458931-33458953 CCTTCTGATCAGCAGAGAGAAGG + Intergenic
905051277 1:35053216-35053238 CCATCTACTCAGGAGGTAGAGGG - Intergenic
907970764 1:59378614-59378636 ACATCTGTTCAGGAGCTTGGTGG - Intronic
908395330 1:63720100-63720122 CCTTCTGTTCACCAGGCAGATGG + Intergenic
908851641 1:68382564-68382586 CCCTCTGTTCAGGATCTCAAAGG - Intergenic
910309665 1:85809144-85809166 CCTACTGCTCAGGAGTTATATGG - Intronic
915853991 1:159361574-159361596 AATTTTGTTCAGGAGGTAGATGG - Intergenic
917895416 1:179482481-179482503 CCATCTGATTGGGAGCTAGAGGG + Intronic
921626826 1:217386397-217386419 CCTGCTGTTCAGGAGAGAAAGGG - Intergenic
1063127691 10:3150129-3150151 CCTTCTGTTGTGGGGCCAGAGGG - Intronic
1065306536 10:24374433-24374455 CCTTGGGTGCAGGCGCTAGAGGG - Intronic
1066413943 10:35201657-35201679 CTTTCATGTCAGGAGCTAGATGG + Intronic
1067477120 10:46574484-46574506 CCTTCTTTTGAGGAGCTTGGAGG - Intergenic
1067617619 10:47767297-47767319 CCTTCTTTTGAGGAGCTTGGAGG + Intergenic
1068384961 10:56314414-56314436 CCTTCTCTACAGGTGTTAGAGGG + Intergenic
1069026938 10:63552623-63552645 CCTTCTTTTCAGTTGATAGATGG + Intronic
1071497712 10:86180157-86180179 CCTTCTGCTCACAAGCTAGCTGG - Intronic
1075991088 10:126839476-126839498 CCCTCTGTTCAGAAGCCAGCTGG - Intergenic
1076751404 10:132545309-132545331 CCCTCTGTCCAGGGGCTAGAGGG + Intronic
1077234166 11:1471977-1471999 CCTTGTGTACAGGGGCAAGAGGG - Intronic
1077722427 11:4642196-4642218 CCTTGTGTTCAGGATGAAGAAGG - Intergenic
1080885635 11:36365151-36365173 CCTTCTGTGAAGGAGGTAGCTGG + Intronic
1081070412 11:38603587-38603609 CCTTCAGGACAGGAGATAGATGG + Intergenic
1082649623 11:55773225-55773247 GCTTCTGTTCAGAAGGTTGATGG + Intergenic
1083992694 11:66256884-66256906 CCTTCTGAGCAGGACCCAGACGG + Intergenic
1086517365 11:87628278-87628300 CCTACTTTTCAGCAGCTAGAAGG + Intergenic
1088801316 11:113309919-113309941 CATTGTGTTGAGGATCTAGAAGG - Intergenic
1089696367 11:120218628-120218650 CCAGCTGTCCAGGAGCAAGAGGG + Intronic
1092469677 12:8766688-8766710 CCTTCAGGACAGGAGATAGAGGG - Intronic
1093006272 12:14054506-14054528 TCTCCTGTTCAGGAGTCAGAAGG + Intergenic
1093912719 12:24765524-24765546 CTTTCTGTTGAGGATCTGGAAGG - Intergenic
1093925532 12:24904675-24904697 CCTACTGCTCAGGAGACAGATGG - Intronic
1095270663 12:40214970-40214992 CCTTCTGGTCAGGAGTTAAGAGG - Intronic
1096939456 12:55326059-55326081 CCTTCTGTTAAGGGGCTGGGGGG - Intergenic
1099265482 12:80441622-80441644 CTTTCTGGTTAAGAGCTAGAAGG - Intronic
1099986043 12:89665709-89665731 CCTTCTGTTCAGGAGCTAGAAGG + Intronic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1100905960 12:99299358-99299380 CCTGCTCTTCAGAAGCTACAAGG - Intronic
1101591582 12:106129891-106129913 CCTGCTACCCAGGAGCTAGATGG - Intronic
1103902477 12:124310560-124310582 CTTTCTGTTGAGGAGCAGGATGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105433864 13:20360820-20360842 CCTTATGTTCAGGAGGCAGATGG + Intergenic
1113574604 13:111385727-111385749 CCCTCTGTTGAGGAGCTAGAAGG - Intergenic
1113734428 13:112667931-112667953 CCTTCTGCTCCTGAGCTACAGGG - Intronic
1114364566 14:22012823-22012845 CCTTTTGTTCTGAAGCCAGATGG + Intergenic
1119666025 14:76485743-76485765 CTGTCTGTGCAGGAACTAGATGG - Intronic
1120933287 14:89870000-89870022 CCATCTGGTCAGGAGAAAGAAGG - Intronic
1121473880 14:94175802-94175824 GCTGCAGTCCAGGAGCTAGAAGG + Intronic
1121743602 14:96270633-96270655 CCTACTTTTCAGGAGCTTCAGGG + Intergenic
1125857678 15:42966075-42966097 CCTTGTATTCATGAGCTTGAAGG + Intronic
1126535854 15:49763409-49763431 TGTTCTTTTCAGGAGCTAAAAGG - Intergenic
1129908693 15:79208239-79208261 CCTTCTGTACAGGATGCAGATGG + Intergenic
1130349959 15:83082874-83082896 CCTCCTGGTCAGGGGCCAGATGG + Intergenic
1131378875 15:91947725-91947747 GCGTCTGTGCAGCAGCTAGACGG + Intronic
1132328755 15:100995725-100995747 GCTCCTGTTCAGCAGTTAGAGGG + Intronic
1133699239 16:8293798-8293820 CCTTCTGTCATGGAGATAGAGGG + Intergenic
1138125627 16:54436169-54436191 CCTTCTGTGGAGAAGCTATAAGG - Intergenic
1138389525 16:56659991-56660013 CCTTCAATTCCTGAGCTAGATGG - Intronic
1138968031 16:62109909-62109931 CCTTCTATTCAGTAGTTTGAGGG - Intergenic
1139517633 16:67461153-67461175 CCTTCTGTACAGGACTTAGTAGG - Intronic
1141584935 16:85027694-85027716 CCTTCTGCGCAGGCGCGAGACGG - Intergenic
1148502574 17:48102757-48102779 CCTTCTAATCAGGAGGAAGAGGG + Intergenic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1150056066 17:62017506-62017528 CCTCCTTTTCAGGGGCTACAGGG + Intronic
1150526852 17:65932592-65932614 CCGTCTGTTCAGCTTCTAGAGGG + Intronic
1151353989 17:73547655-73547677 CCTTCTGACCAAGAGCTTGAAGG - Intronic
1151804561 17:76397385-76397407 CCTTCTGCTCAGGACCCAGCAGG + Intronic
1153651594 18:7245824-7245846 CCATGGCTTCAGGAGCTAGAAGG - Intergenic
1157150572 18:45213219-45213241 CCATGTCTTCAGGATCTAGAAGG + Intronic
1160306599 18:77745614-77745636 TCTTCTGTTCAGTGGCTGGAAGG + Intergenic
1162192557 19:8958532-8958554 CTTTCAGTTCAGGAGTCAGAGGG + Exonic
1166713475 19:44951669-44951691 CCTTCTCCTCAGGACCTAGAAGG + Intronic
925949394 2:8896832-8896854 CCTTCAGGACAGGAGATAGATGG - Intronic
926687995 2:15712945-15712967 CCCACTGTGCAGGAGCTAGGAGG + Intronic
926704199 2:15825351-15825373 CCTTCCCACCAGGAGCTAGAGGG - Intergenic
929023456 2:37576660-37576682 CCTCCACTTCAGGAGATAGAGGG - Intergenic
933390347 2:81658785-81658807 CCTACTGGTCAGAAGCAAGATGG + Intergenic
933732572 2:85468621-85468643 CCTTCTTTTCAGGATGTAGGAGG + Intergenic
934119040 2:88822698-88822720 CCTACTGTTTAGGAGGTAGAGGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934516004 2:94987238-94987260 CCTACTGTTTAGGAGCCAGAGGG + Intergenic
936162492 2:110095050-110095072 CCTCCTGTTTAGGAGGTAGAGGG - Intronic
936182168 2:110276316-110276338 CCTCCTGTTTAGGAGGTAGAGGG + Intergenic
941959022 2:171235524-171235546 GCTTCTGTGCAGGAGATAGGAGG + Intergenic
942066864 2:172279703-172279725 TCTTCTGTTCAGGAGTTTTAGGG - Intergenic
944779411 2:203002753-203002775 CCTTGTTTTCAGCAGGTAGAAGG + Intronic
945528314 2:210917763-210917785 GCTTCTGTGCATGAACTAGAAGG + Intergenic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1170953173 20:20955195-20955217 CCTCCTGTCCAGGAGTCAGATGG - Intergenic
1173112300 20:40203484-40203506 GCTTCTGATAAGCAGCTAGAAGG + Intergenic
1173955851 20:47031991-47032013 CCTTCTGTTCAGGAATTGAAAGG + Intronic
1174439763 20:50541188-50541210 CCTTCTGTTAAGGAGGTCAAGGG + Intronic
1177590985 21:23167527-23167549 CCTTCTGATTAAGAGTTAGAAGG + Intergenic
1178174989 21:30086337-30086359 CCGTCTATTCAGGAGTGAGAGGG - Intergenic
1180656464 22:17425351-17425373 CCTTCTGTTCTGGACCTATTTGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183022473 22:35038460-35038482 CCTGCTGTTCTGGAACTGGAAGG - Intergenic
1185131604 22:49042608-49042630 CCTACTTTTCAGCAGCCAGAAGG - Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
954767688 3:52934814-52934836 CCTCCTGTTCCGCTGCTAGAGGG - Exonic
955910488 3:63854674-63854696 CAGTCTTTCCAGGAGCTAGATGG - Intronic
957351791 3:79032934-79032956 ACTTCTGTTCATTAACTAGATGG + Intronic
958630028 3:96672543-96672565 CCTTCAGGACAGGAGATAGATGG - Intergenic
964696749 3:159516566-159516588 CCTTCCATTCTGCAGCTAGATGG + Intronic
964721275 3:159769234-159769256 CCTTTTGAACAGGAGCAAGAGGG - Intronic
965499230 3:169437727-169437749 CCTTCTCTCCAGGTGCTAAAGGG + Intronic
971120396 4:23697967-23697989 TTTTCTGTTCTGGAGCTAGCTGG - Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
972794391 4:42400699-42400721 TCTCCTGTTCAGGCACTAGAGGG - Intronic
976407825 4:84679532-84679554 CCTGCTGTGCTGCAGCTAGATGG + Intronic
981007927 4:139894674-139894696 CCTTGTGTTCAGCAGTTCGAGGG - Intronic
983876066 4:172875599-172875621 CCTGCTGTTCAGTAGGTGGATGG - Intronic
990336580 5:54778452-54778474 CCTTCTGTTCAGGAGTTATCTGG - Intergenic
993553001 5:89298716-89298738 CCTTCTGTTCAGGTCCTAGCAGG - Intergenic
995394908 5:111677136-111677158 TCTTCTGATCAGGAGGAAGAAGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997422908 5:133783293-133783315 CCTGCTCTTCAGAAGCCAGAAGG + Intergenic
997821507 5:137070191-137070213 CCTTCTGCCCAGGACCCAGAAGG + Intronic
1002769225 6:276152-276174 CCTTATGATCAGGAACAAGAAGG - Intergenic
1002945564 6:1758099-1758121 CCTTATGTTCAAGAGGGAGAAGG + Intronic
1004478154 6:15993647-15993669 CCTTCAGTTCAGGGCCTAGAAGG - Intergenic
1006910247 6:37558879-37558901 CCGGCTGTTCAGGAGCTGGCAGG - Intergenic
1011012038 6:82713606-82713628 CTTCCTGTTTAGGAGCCAGAGGG - Intergenic
1012343030 6:98152336-98152358 TCTTATGTTCAGGATCTACAAGG - Intergenic
1015404124 6:132818264-132818286 CCTTTTGTGCAGGAGCGAGAGGG + Intergenic
1017896802 6:158687022-158687044 ACTTCTGCTCAGGATATAGAGGG - Intronic
1018894761 6:168006022-168006044 CCTTCAGTGCAGGAGGAAGAGGG + Intronic
1028391236 7:90320346-90320368 CCCTCTGTTTAGGAGCTGGTTGG + Intergenic
1030160662 7:106505322-106505344 TCTTCTGCTCAGGAGATACAGGG - Intergenic
1030911806 7:115259433-115259455 CCTGCTGTTTAGGAGAAAGATGG - Intergenic
1031471269 7:122172097-122172119 CCTTCGGGACAGGAGATAGATGG + Intergenic
1032474201 7:132201248-132201270 CCTGCCGTTCAGGAGGTAGACGG - Intronic
1035446064 7:158943977-158943999 CCTCCTGTTGAGCAGCCAGAGGG + Intronic
1035448219 7:158957467-158957489 TATTCTGTTCAGGAGCTACCTGG - Intergenic
1035481349 7:159189577-159189599 CCTTCTATTCATGAGGTATATGG - Intergenic
1037935873 8:22914708-22914730 CCTTCTCTTCTGGAGTCAGATGG + Intronic
1039662547 8:39482886-39482908 CTTTTTGTTCATGAGCAAGAGGG + Intergenic
1039877431 8:41598979-41599001 CCTTCTATTCAGGCGGTTGAAGG + Exonic
1040987683 8:53314364-53314386 AATTCTGTTCAGGTGCAAGATGG - Intergenic
1041888269 8:62838951-62838973 CCTTGTACTCAGGAGCAAGATGG - Intronic
1042358145 8:67852463-67852485 CCTTCTTTTAAGGCCCTAGAAGG - Intergenic
1044083511 8:87914597-87914619 CCTTCTGTTCAAGAGCCTTAAGG + Intergenic
1044738803 8:95304769-95304791 CCTTCTCTTCAGGATTTGGAAGG - Intergenic
1045735148 8:105286923-105286945 CCTTATGTTTATGAGCTTGAAGG + Intronic
1057730421 9:97603488-97603510 CGATCTGTTTTGGAGCTAGATGG - Intronic
1059155914 9:111988171-111988193 CCTTCTCTTCAGAAGCTAGAAGG - Intergenic
1059335009 9:113563591-113563613 CCTGCTTTTCAGGAGCCAGCAGG + Intronic
1060428343 9:123525593-123525615 CCTGCTCTACAGGAGCTAAAGGG + Intronic
1062514622 9:136926381-136926403 CCTTCTCTCCAGGGGCCAGAGGG - Exonic
1186272127 X:7900278-7900300 CCTTCAGTTCCAGAGCTACAGGG + Exonic
1188081855 X:25852862-25852884 CCTTATGTTCAGAAGCCAGCTGG + Intergenic
1189034405 X:37480750-37480772 CCTTCAGGACAGGAGATAGATGG + Intronic
1189452967 X:41156691-41156713 GTTACTGTTCAGGAGATAGAGGG - Intronic
1192052189 X:67734380-67734402 CCTTCTGTTTGGGAACTAGTGGG + Intergenic
1196614122 X:117748186-117748208 CCTTCTGTTCTGGATCTAAGAGG - Intergenic
1197712920 X:129684966-129684988 CCATATGTTCATGACCTAGAAGG - Intergenic
1199808223 X:151323350-151323372 TCTTCAGTGCAGGAGCAAGAAGG - Intergenic
1199914080 X:152320026-152320048 CCATCCTTTCAGGAGCTAGGTGG - Intronic
1199942942 X:152642138-152642160 CCTTCTGTTTAAATGCTAGAAGG - Intronic